Labshake search
Citations for Roche :
201 - 250 of 6291 citations for 6 Oxa 3 azabicyclo 3.1.0 hexane 3 1 methylpropyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche). The reaction was stopped with PBS and the sections were mounted in Glycergel (Dako) ...
-
bioRxiv - Developmental Biology 2023Quote: ... After a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 (Roche), trypsin B (BI) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3×10−4 M MTG and 300 μg/ml human transferrin (Roche, 10652202001)) in a triple vent petri 10 cm dishes (Thermo fisher ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% BSA/TBS-T) at 4°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5% Normal Goat Serum) for 3 h at room temperature and then incubated overnight with alkaline phosphatase-conjugated anti-DIG Fab fragments (Roche, 1: 2,000) at 4°C on a shaking platform ...
-
bioRxiv - Neuroscience 2020Quote: ... 1996) on 16 µm cryosections at post-natal day 3 (P3) using anti-digoxigenin antibody (Sheep polyclonal, 1:1000, Roche, 11093274910, RRID:AB_514497). Two days exposure to alkaline phosphatase (AP ...
-
bioRxiv - Physiology 2021Quote: ... a 6.7 kb DNA fragment starting 1 kb upstream of murine Gnrhr exon 3 was amplified by PCR using the Expand Long Template PCR System (Roche, Basel, Switzerland) from 129SvEv genomic DNA using primers incorporating 5’ XmaI and 3’ NotI restriction enzyme sites (Table 1) ...
-
bioRxiv - Biophysics 2019Quote: ... or for confocal in a alkaline-washed glass-bottomed chamber coated with human plasma fibronectin (25 µg/mL at 4°C overnight in 1/3 X MBS; Roche Molecular Biochemicals) in DFA supplemented with antibiotic/antimycotic (Sigma) ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were lysed in 50 µl of lysis buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1× Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Immunology 2023Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 μg/ml taxol, 3 U/ml DNAse I, 10 μg/ml RNAse A, 1 U/ml micrococcal nuclease, and Roche Complete Protease Inhibitors) and vortexed vigorously for 1 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and Nitro Blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate NBT/BCIP (Roche Diagnostics). In situ hybridizations were based on the Carroll lab “Drosophila abdominal in situ” protocol (http://carroll.molbio.wisc.edu/methods.html ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were then digested for a further 3 hrs with 2 μg Chymotrypsin (Roche 11418467001) at 25°C ...
-
bioRxiv - Neuroscience 2020Quote: ... which were stained with 5-bromo-4-cloro-3-indlyl phosphate/nitro blue tetrazolium (Roche) chromogenic substrates.
-
bioRxiv - Developmental Biology 2020Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained embryos and gonads were embedded in gelatin ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then pelleted and washed 3 times with PBS containing protease inhibitor (Roche, 11873580001). The pellets were snap-frozen and stored at -80°C for later use ...
-
bioRxiv - Neuroscience 2020Quote: ... MgCl2 50 mM] and incubated in 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche) and 4-nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated in nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate solution (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... and nitro-blue tetrazolium chloride (NBT)/5-bromo-4-chloro-3′-indolyphosphate (BCIP) substrate (Roche) according to published protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) reaction (Roche). After in situ hybridization ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were lysed at 3 days in ice-cold RIPA buffer containing protease inhibitors (Roche) and protein concentration was determined by BCA Assay (Gibco BRL ...
-
bioRxiv - Genomics 2019Quote: ... beads were washed 3×1mL with bead wash buffer (1x PBS, 5mg/mL BSA, Roche complete EDTA-free protease inhibitor ...