Labshake search
Citations for Roche :
151 - 200 of 1004 citations for 6 Iodo 1H indole 3 carboxylic acid methyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were blocked in Blocking Buffer + Maleic Acid (Roche, 11585762001) for at least 3 hours before the anti-DIG antibody was added in a concentration of 1:5000 and incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5% deoxycholic acid) containing inhibitors of phosphatases (1:10 PhosphoStop; Roche) and proteases (1:100 Protease Inhibitor Cocktail ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by optional sialic acid removal using 0.02 U sialidase (Roche), prior to in-gel trypsin treatment49 ...
-
bioRxiv - Plant Biology 2020Quote: ... Digoxigenin was detected using DIG Nucleic Acid Detection Kit (Roche, USA).
-
bioRxiv - Systems Biology 2021Quote: ... 2% fatty acid-free bovine serum albumin (BSA) fraction V (Roche), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... 0,002% mellitic acid and 1 pastil of protease inhibitors cocktail (Roche)).
-
bioRxiv - Neuroscience 2021Quote: ... 25 nM okadaic acid and a protease inhibitor cocktail tablet (Roche). Soluble and insoluble fractions of total homogenates were obtained as previously described (30) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 x Protease Inhibitor cocktail ethylenediaminetetraacetic acid (EDTA)-free (PI, Roche), 10 mM NaF (Nacalai tesque) ...
-
bioRxiv - Biophysics 2022Quote: ... 1 tablet ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche diagnostics, GmbH), pH 8) ...
-
bioRxiv - Neuroscience 2023Quote: ... and ethylenediaminetetraacetic acid-free Complete Protease Inhibitor Cocktail (Roche Applied Science). After centrifugation at 20,000[×[g for 30 min at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 tablet crushed complete EDTA (ethylenediaminetetraacetic acid)-free protease inhibitor (Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Universal probe library (UPL) probe #3 (Roche) and following primers were used for analysis of wtAAV2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% Tween-20 (Roche 11332465001), freshly add 3 µL 1:1 water diluted digitonin (Promega G9441) ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 uL of DNaseI (10U/ul Roche), 8 uL buffer (200 mM Tris ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... and 0.2 μl of glucose-6-phosphate isomerase (PGI, Roche, #10127396001), while another 20 μl was incubated with 980 μl Glucose Reagent (Thermo Scientific ...
-
bioRxiv - Immunology 2022Quote: ... nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Roche) for 4 min at room temperature and observed them under a Laserscaing Confocal Microscopy (TCS SP8 STED ...
-
bioRxiv - Cell Biology 2020Quote: ... and Hexokinase + Glucose-6-Phosphate dehydrogenase at dilution 1:200 (Roche), for 15 min at 25°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Genomics 2021Quote: ... using 6 ml of FuGENE HD transfection reagent (Roche Diagnostic, USA) in 100ml of OPTIMEM medium (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: Cells were transfected with the appropriate plasmids using Fugene 6 (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and RCAS-Cre using a Fugene 6 transfection kit (Roche, 11814443001) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... or 1µg/mL 4’,6’-diamidine-2’-phenylindole dihydrochloride (DAPI) (Roche).
-
bioRxiv - Cell Biology 2023Quote: ... with virus packaging and envelope expressing plasmids using Fugene-6 (Roche). Medium was replaced with DMEM with 10% FCS the next day and supernatant was harvested 3 days post-transfection ...
-
bioRxiv - Immunology 2023Quote: ... T237M or V1092A mutated hALPK1 cDNA constructs using FuGENE 6 (Roche).
-
bioRxiv - Immunology 2023Quote: ... samples were counterstained with 4’,6-Diamidino-2-phenylindol (DAPI, Roche).
-
bioRxiv - Molecular Biology 2024Quote: ... at a ratio of 6:1 using lipofectamine (Roche, catalog #6365787001), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... in Tris calcium buffer with ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche) were added and the pellet resuspended ...
-
bioRxiv - Genetics 2021Quote: ... with the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics) according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Total RNA was isolated via MPLC Total Nucleic Acid Isolation Kit (Roche) using automated MagNA Pure LC Instrument (Roche) ...
-
bioRxiv - Neuroscience 2019Quote: ... pH 8.0) supplemented with ethylenediaminetetraacetic acid and cOmplete protease inhibitor cocktail (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2019Quote: ... Slides were then blocked with 0.5% nucleic acid blocking reagent (Roche 11096176001) dissolved in a 1x PBS containing maleic acid (Sigma M0375 ...
-
bioRxiv - Genetics 2020Quote: ... acid-extracted histones were digested with Asp-N and Arg-C (Roche) and the resulting digests were analyzed by chromatography on an Ultimate 3000 nanoLC (Dionex ...
-
bioRxiv - Microbiology 2020Quote: Escherichia coli MRE600 total transfer ribonucleic acid was purchased from Roche (Switzerland). Biotin labeled single-stranded DNA oligonucleotides were obtained from B.G.I. ...
-
bioRxiv - Genetics 2023Quote: ... 1×EDTA (Ethylene Diamine Tetraacetic Acid)-free protease inhibitor cocktail (Roche 04693132001). The larvae were then crosslinked by adding formaldehyde to a 1.8% concentration and incubating for 5mins at RT on a rotator ...
-
bioRxiv - Neuroscience 2024Quote: ... ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail tablets (plus protease inhibitors) (Roche). For experiments where separate measurements were made in ganglia versus neurites ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...