Labshake search
Citations for Roche :
401 - 450 of 1185 citations for 6 FLUORO 4 METHYLCOUMARIN 3 CARBONITRIL& since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Poly-guanine was added at the cDNAs 3’ end using Terminal Transferase (Roche) and dGTPs ...
-
bioRxiv - Biophysics 2022Quote: GGCAGCGCTACCATAACGGA-3’) (11) by RT-qPCR was performed using LightCycler 480 II (Roche). GAPDH mRNAs were used as a loading control (14) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Developmental Biology 2023Quote: ... After a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 (Roche), trypsin B (BI) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Signals were developed using 4-nitro blue tetrazolium chloride (NBT, Roche) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.25% Triton supplemented with protease inhibitor at 4□°C (Roche, 04693159001) for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with protease inhibitors (4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (Roche), benzamidine ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 mM MgSO4) containing Complete Inhibitor Protease Cocktail (Roche, Indianapolis, IN), lysozyme and DNAse ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... at 4°C overnight and subsequently developed with NBT/BCIP (Roche). For FISH ...
-
bioRxiv - Neuroscience 2020Quote: ... at 4°C with alkaline phosphate anti-DIG (1:2000, Roche). For chromogenic revelation ...
-
bioRxiv - Physiology 2020Quote: ... containing 0.2 mg 4-(2-aminoethyl)-benzene-sulfonyl fluoride (AEBSF, Roche). Serum from blood samples was obtained by centrifugation at 3,000 rpm for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 complete-EDTA protease-inhibitor tablets per 500 mL (Roche). After thawing ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA (4 ng) and LightCycler 480 SYBR Green I Master (Roche) in a final volume of 10 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... 4% BlockAce (DS Pharma Biomedical) and 0.5× Blocking reagent (Roche Diagnostics)] for 1 hr at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Immunohistochemistry was performed on 4 μm sections using the BenchmarkUltra (Roche), anti-hCD45 (M0701 ...
-
bioRxiv - Plant Biology 2023Quote: ... 1/200 mM NaF) containing 4 tablets of protease inhibitor (Roche cOmplete ...
-
bioRxiv - Neuroscience 2024Quote: ... and detection with 4-Nitro blue tetrazolium chloride (NBT; 11383213001, Roche) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Cell Biology 2019Quote: ... pH 7.6, 150 mM NaCl, 1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, and 1 x protease inhibitors [Roche]) was added per well ...
-
bioRxiv - Molecular Biology 2019Quote: pLKO.1 lentiviral construct along with packaging vector ΔVPR and VSVG plasmids were transfected using Fugene-6 (Roche) or PEI (POLYSCIENCES 23966-2 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were seeded in 10 cm tissue-culture treated dishes and transfected with FuGENE 6® reagent (Roche) for 24 hr ...
-
bioRxiv - Biochemistry 2022Quote: (His)6-GST-SNX15 MIT was bound to cOmplete His-Tag purification beads (5 mL, Roche, Germany, 2h) and washed with 2 L wash buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... hDAT and Stx1 constructs were transiently cotransfected into these cells (hDAT cells) using Fugene-6 (Roche Molecular Biochemicals) per the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... The mini-genes in the pSPL3b vector were transiently transfected using 6µl of FuGENE 6 Transfection Reagent (Roche) with 2 µg of vector ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... five pupae were homogenized in 100uL of homogenization buffer (125 mM Tris pH 6.8, 6% SDS, 2.5X Roche cOmplete protease inhibitor cocktail ...
-
bioRxiv - Neuroscience 2023Quote: ... Vectors were co-transfected with packaging-defective helper plasmids into 293T cells using Fugene 6 transfection reagent (Roche). Fibroblasts were plated at a density of 50,000 cells/well on 0.1% gelatin-coated 6-well plates and infected three times with a viral cocktail containing vectors expressing OCT4:SOX2:KLF4:cMYC in a 2:1:1:1 ratio in the presence of 6 µg/ml protamine sulfate (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant containing chromatin fragments was then treated with 6-10 µg/g cells DNase-free RNase (Roche) at 37°C for 30 minutes and subsequently cleared by centrifugation at 30,000 rcf for 30 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Both were fragmented at 94°C for 6 min and ligated with KAPA Unique Dual-Indexed adaptors (Roche). Library quality was checked on an AATI (now Agilent ...
-
bioRxiv - Biochemistry 2024Quote: ... an additional 6-cycle PCR was carried out with the HiFi HotStart Ready Mix (Kapa Biosystems, Wilmington, MA) and primers that preserve the DNA sequence ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1-3 ng of ChIP DNA with KAPA Library Preparation Kit (KAPA Biosystems) and NimbleGen SeqCap Adaptor Kit A or B (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Immunology 2023Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Biochemistry 2022Quote: ... The cell pellet collected from 6 L growth was resuspended in 20 mM HEPES (pH 7.8) containing protease inhibitor cocktail (Roche) and DNase I (Sigma) ...