Labshake search
Citations for Roche :
51 - 100 of 3252 citations for 6 Chloro N 5 ethoxy 1H pyrazol 3 yl 3 nitropyridin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Plant Biology 2021Quote: ... in paraffin-embedded sections (8µm) and color was detected with 5-bromo-4-chloroindol-3-yl phosphate/nitrateblue tetrazolium (BCIP/NBT) (Roche).
-
bioRxiv - Developmental Biology 2021Quote: ... Gene expression signals were visualized using nitroblue tetrazolium/5-bromo-4-chloro-3-indolylphosphate solutions using a standard method (Roche). Whole-mount and sectioned specimens of Ciona were observed using an SZX12 stereo microscope (Olympus ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by visualization with nitro blue tetrazolium and 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) (Roche Diagnostics, Basel, Switzerland). Embryos were imaged using a Leica M205 FA epifluorescence microscope (Leica ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were subsequently incubated in the dark on a slow rocker in dilutions of Nitro-blue tetrazolium/5-bromo-4-chloro-3-inodyl phosphate (NBT/BCIP; Roche) in TBST ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of DIG-probes was made in staining buffer (in 10% polyvinyl alcohol) supplemented with nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate (BCIP) (Roche). In addition ...
-
bioRxiv - Developmental Biology 2022Quote: ... Signal was revealed with 4 μL of NitroBlue Tetrazolium/5-Bromo-4-Chloro-3-Indolyl Phosphate (NBT/BCIP) Stock Solution (Roche)/ml of AP reaction buffer ...
-
bioRxiv - Genetics 2022Quote: ... Expression patterns were visualized with a Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3-Indolyphosphate p-Toluidine Salt (NBT/BCIP) system (Roche). Sections were mounted with Vectamount (Vector laboratories ...
-
bioRxiv - Developmental Biology 2019Quote: ... and then incubated at room temperature in the same solution containing NBT-BCIP (nitrotetrazolium blue chloride at 350 µg/ml and 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt at 175 µg/ml) (Roche) until the color appeared ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1% Tween 20 in water) and incubated in NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) solution (Roche).
-
bioRxiv - Cell Biology 2021Quote: ... Cardiac tissue sections were either stained for 5-bromo-4-chloro-3-indolyl-b-galactosidase (Xgal; Roche Cat #XGAL-RO) or immunostained with rabbit anti-mouse polyclonal Ror2 (provided by Dr ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was washed again with 1x TBST 3-5 times for a total of 20 min and developed using 5-bromo-4-chloro-3-indolylphosphate (BCIP)/ nitro-blue tetrazolium (NBT) (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Hybridised probes were detected with anti-DIG antibodies and revealed with alkaline phosphatase-conjugated antibodies in presence of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Roche).
-
bioRxiv - Neuroscience 2022Quote: ... Alkaline phosphate labeling was detected by incubation overnight at room temperature in the dark with a nitroblue tetrazolium plus 5-bromo-4-chloro-3 indolyl-phosphate mixture (Roche) with levamisole (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... slides were incubated at 37oC in a staining solution containing nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche) for 20-24 hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.1% Tween 20 in water) and incubated in NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) solution (Roche).
-
bioRxiv - Pathology 2023Quote: ... Bound alkaline phosphatase was visualized with nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP; 11681451001, Roche). The reaction was stopped by incubation in buffer 4 (10 mM Tris and 1 mM EDTA ...
-
bioRxiv - Molecular Biology 2023Quote: ... The signals were detected by 4-nitro-blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP, Roche Diagnostics) in a humidified container for 72 h at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... and developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indoxyl phosphate (BCIP; Roche, Switzerland) for 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... and then the detection reaction was carried out in a buffer containing 3.5 µl/ml of of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Bâle, Switzerland). The reaction was stopped with 50 mM EDTA in PBS and embryos were washed in PBSTw ...
-
bioRxiv - Neuroscience 2023Quote: ... The hybridization signal was revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 in a proportion of 0.45 µl of NBT and 4.5 µl of BCIP in 5 ml of B2 ...
-
bioRxiv - Zoology 2023Quote: ... Single staining was performed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP; 1:50 dilution in alkaline buffer; Roche Diagnostics). The cells were then stained overnight at room temperature.
-
bioRxiv - Microbiology 2024Quote: ... and the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 4-nitroblue tetrazolium chloride (NBT) (Roche Diagnostics). After washing ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... 10 μL / well of MTT (3- [4,5-dimethylthiazol-2-yl] −0,5-diphenyl tetrazolium bromide (11465007001; Roche Life Science, Mannheim, Germany) labeling reagent (1× ...
-
bioRxiv - Molecular Biology 2019Quote: ... and viability was measured using the Roche MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) kit (Roche, Cat # 11465007001) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: Metabolic activity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)-assay (Cell Proliferation Kit I, Roche Germany, Mannheim) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: Cell viability was determined by MTT (C, N-diphenyl-N′-4,5-dimethyl thiazol-2-yl tetrazolium bromide) assay (Roche, Switzerland), a standard colorimetric assay which uses the metabolic reduction of the tetrazolium salt to form the colored formazan product [33] ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... 18.75 mg/ml nitro blue tetrazolium chloride, 9.4 mg/ml 5-bromo-4-chloro-3-indolyl phosphate toluidine salt in 67% dimethyl sulfoxide, Roche; Cat. No. 1681451) was added to the third change of NDB while stirring thoroughly until completely dissolved ...
-
bioRxiv - Neuroscience 2019Quote: ... BCIP (5-Bromo-4-chloro-3-indolyl-phosphate, 4-toluidene salt, Roche, Cat. No. 11 383 221 001. 105 µl/40 ml) and Levamisole (Vector ...
-
bioRxiv - Neuroscience 2020Quote: ... the signal was visualized by incubation with nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolylphosphate (BCIP) solution (Roche Diagnostics, 11681451001) in 0.1 M Tris-HCl (pH9.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1% (v/v) 2-mercaptoethanol and 60 × 10−3 М n-Octyl-β-D-Glucopyranoside) containing protease inhibitor (Roche). Total protein was collected and incubated with anti-p75NTR (Alomone ...
-
bioRxiv - Immunology 2021Quote: ... and 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) (pH 8.0) and the presence of Complete® protease inhibitor (Roche). The preparation was centrifuged for 10 min at 2500 rpm and 4 °C and supernatant was transferred to a new tube and centrifuged for 40 min at 30,000 x g and 4 °C ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... ∼200-300 embryos were dechorionated 3-6 hours after injection by 5 min incubation in 1 mg/ml pronase (Roche) in E3 medium in a 2% agarose-coated petri dish and washed with excess amount of fresh E3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was set by using qPCRBIO Probe Mix Hi-ROX (Nippongenetics) and TaqMan (5’: 6-FAM, 3’: TAMRA) or UPL (Universal Probe Library, Roche) probes ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3 and 6 post transfection using WST-1 dye (Roche, Basel, Switzerland) as previously described 17.