Labshake search
Citations for Roche :
551 - 600 of 2093 citations for 6 Chloro 2 Methoxy 3 Nitropyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Single cell transcriptomics reveals the effect of PD-L1/TGF-β blockade on the tumor microenvironmentbioRxiv - Genomics 2020Quote: ... anti-PD-L1 (atezolizumab, Roche, 2 mg/kg), or a combination of anti-PD-L1 (2 mg/kg ...
-
bioRxiv - Developmental Biology 2019Quote: ... blocked with 2% blocking reagent (Roche, Basel, Switzerland), 2% bovine serum albumen ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µl 5x KAPA HiFi buffer (Kapa Biosystems), 0.3 µl 10 mM dNTPs (Kapa Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 µg/mL Liberase Blendzyme 2 (Roche, 05401020001) and 5 ml of Penicillin/Streptomycin (Gibco Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/ml of interleukin-2 (Roche) (complete IMDM) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 mM EDTA with 1x protease inhibitors (Roche). 50 ug lysate was used for label free quantification at the Rockefeller University Proteomics Core Facility ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mM MgCl2 with protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Bioengineering 2021Quote: ... and 2 mg/ml DNase I (Roche, 11284932001) to obtain a single cell suspension.
-
bioRxiv - Cell Biology 2020Quote: ... and 2 μg/ml collagenase A (Roche 10103586001). Tissue preparations were incubated at 37 °C in a water bath (in gently shaking and not in immersion ...
-
bioRxiv - Immunology 2021Quote: ... then with Collagenase/Dispase (2 mg/mL) (Roche) and DNase I (2 mg/mL ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 mg ml-1 collagenase/ dispase (Roche) and 0.2 mg ml-1 DNase I (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x KAPA HiFi buffer (Kapa Biosystems), 0.3 µl 10 mM dNTPs (Kapa Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... and IL-2 (50/250 IU/ml) (Roche). The glucose medium consisted of glucose-free RPMI 1640 (Gibco ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 μl alkaline phosphatase (Roche Basel, Switzerland) were added and incubated overnight in the dark at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... and 10 U mL−1 IL-2 (Roche) for 48 h at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mg/ml Lysozyme and protease inhibitors (Roche) per 1 L of pelleted culture ...
-
Phosphorylation of the Smooth Muscle Master Splicing Regulator RBPMS Regulates its Splicing ActivitybioRxiv - Molecular Biology 2022Quote: ... and 2 cOmpleteTM mini protease inhibitor cocktail (Roche) tablets were added to the cell suspension followed by cell lysis using a French Press (Stansted) ...
-
bioRxiv - Molecular Biology 2023Quote: ... BSA fraction V (2% wt/vol) (Roche Diagnostics), 2-mercaptoethanol (50 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 tablets complete EDTA-free protease inhibitor (Roche)) followed by 5 min incubation at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 ml of diluted Liberase TH (Roche, 05401151001) was then added to the plate ...
-
bioRxiv - Cell Biology 2023Quote: ... digested in 2 mg/ml Collagenase P (Roche) for 45 min and filtered through sieves with 70 and 40 µm pore size ...
-
bioRxiv - Molecular Biology 2023Quote: ... and KAPA HiFi Uracil+ mastermix (Roche, KK2801/2) using the following protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% sodium dodecyl buffer (SDS)] containing protease (Roche) and phosphatase (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mg/ml lysozyme and protease inhibitors (Roche) per 1 L of culture ...
-
bioRxiv - Neuroscience 2022Quote: ... 2% SDS and a cocktail protease inhibitor (Roche)] ...
-
bioRxiv - Cell Biology 2023Quote: ... 5mM EDTA and 2% Protease inhibitor (Roche, Complete) boiled for 10 min at 70°C in SDS loading buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.01% digitonin + 2 U/mL RNase inhibitor (Roche). Epicardial preparations (2 biological replicates at 10PWC ...
-
bioRxiv - Microbiology 2023Quote: ... and 2) a KAPA HiFi PCR kit (Roche) was used to perform the amplification in place of the reagents included in the Nextera XT kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 tablets complete EDTA-free protease inhibitor (Roche)) followed by 5 min incubation at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL 20 mg/mL Glycogen (Roche, 10901393001)) at 37°C for 2 hr and subsequently subjected to Proteinase K (15 μL 10% SDS ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 2 mg/ml collagenase/dispase (Roche, 10269638) at 37°C for 40 min with gentle agitation ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mg/ml collagenase A (#1013586001, Roche, Switzerland), 0.2 mM CaCl2 (#C5670 ...
-
Identification of plants functional counterparts of the metazoan Mediator of DNA Damage Checkpoint 1bioRxiv - Cell Biology 2023Quote: ... 2 µl/ml Benzonase) containing protease inhibitors (Roche) and sonicated for 2 min (5’’on/5’’off ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μl of micrococcal nuclease (Nuclease S7, Roche) was added and the lysates were incubated at 25 °C for 18 min using a thermal cycler (Techne-Prime ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 mM EDTA complemented with phosphatase ihibitor (Roche Diagnostics Scandinavia AB ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM DTT with Protease inhibitor cocktail (Roche) and incubated for 10 min on ice ...
-
Neuroprotective Effects of VEGF-B in a Murine Model of Aggressive Neuronal Loss With Childhood OnsetbioRxiv - Neuroscience 2023Quote: ... Terminal transferase (2 µl/ml; Roche, Basel, Switzerland) and biotinylated dUTP (1 µl/ml ...
-
bioRxiv - Immunology 2021Quote: ... which were subsequently incubated with digestion buffer (IMDM supplemented with 2% FBS, 1 mg/mL Collagenase D [Roche], 2 U/mL DNase I [Life Technologies] and Dispase II [Roche]). The digested brain parenchyma ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mM MgCl2; 2 mM EGTA pH 8.0; 0.1% Triton X-100; 0.1 mM PMSF; 1x Roche Complete protease inhibitors cocktail) supplemented with increasing NaCl concentrations (80-600 mM ...
-
bioRxiv - Cancer Biology 2022Quote: NGS libraries were prepared from extracted gDNAs following a 2-step PCR protocol with 2 x KAPA Mastermix (KK2612, KAPA Biosystems). For spleen Tregs and CD4s ...
-
bioRxiv - Cancer Biology 2024Quote: ... The aqueous phase from each MaXtract tube (∼400 µl) was then transferred to 1.5 ml tubes containing 2 µl of 2 µg/µl glycogen (Roche, Cat# 10901393001), 1 ml ethanol was added ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1-3 ng of ChIP DNA with KAPA Library Preparation Kit (KAPA Biosystems) and NimbleGen SeqCap Adaptor Kit A or B (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...