Labshake search
Citations for Roche :
201 - 250 of 7724 citations for 6 Chloro 1 2 4 triazolo 4 3 b pyridazin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... at 4°C with alkaline phosphate anti-DIG (1:2000, Roche). For chromogenic revelation ...
-
bioRxiv - Plant Biology 2023Quote: ... 1/200 mM NaF) containing 4 tablets of protease inhibitor (Roche cOmplete ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Microbiology 2021Quote: ... 3 mM DTT and 1 mM PMSF) supplemented with protease inhibitor cocktail (Roche). Zirconium beads equivalent to 100 µL volume was added in microcentrifuge tubes and resuspended cells were lysed by 6 rounds of bead beating on a bullet blender ...
-
bioRxiv - Plant Biology 2020Quote: ... in a total volume of 6 μL containing 0.5 mM of each specific primer and 3 μl of SYBR Green I Master Mix (Roche Applied Science). The second derivative maximum method was used to determine Cp values and PCR efficiencies were determined using LinRegPCR software (http://LinRegPCR.nl) ...
-
bioRxiv - Developmental Biology 2022Quote: ... sections were blocked with 10% HI-serum for 2 h and incubated overnight at 4°C with alkaline phosphatase-labeled sheep anti-dig antibody (11093274910, Roche; 1:2500). After washing ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4-toluidine salt (BCIP, Roche) in NTMT buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 4 U DNase I (Roche) with the reaction buffer provided with the enzyme for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 mM MgCl2 (Roche Diagnostics), 0.3 µM of each primer (RB1_80F and RB1_235R ...
-
bioRxiv - Molecular Biology 2023Quote: ... a total of 0.4–0.5 μg of plasmid and dsRNAs were transfected into BmN4 cells (4–6 × 104 cells per glass bottom 35 mm dish) with X-tremeGENE HP DNA Transfection Reagent (Merck Millipore/Roche) and cells were fixed 5–6 days later ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Universal probe library (UPL) probe #3 (Roche) and following primers were used for analysis of wtAAV2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% Tween-20 (Roche 11332465001), freshly add 3 µL 1:1 water diluted digitonin (Promega G9441) ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 uL of DNaseI (10U/ul Roche), 8 uL buffer (200 mM Tris ...
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 100 μg/ml AEBSF [4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride] and protease inhibitors cocktail (Complete, Roche). Cells were cracked by multiple passages through a microfluidizer system using a pressure of 18’000 psi ...
-
bioRxiv - Microbiology 2020Quote: ... NimbleGen 4-plex arrays containing 4 × 72,000 arrays per slide were used (Roche, Mannheim, Germany). Construction of this chip was initially based on combining two previous genome annotations (Amselem et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μg of plasmid and 4 μl of X-tremeGENE HP DNA Transfection Reagent (Roche) were used per well ...
-
bioRxiv - Cell Biology 2020Quote: ... resuspended in SDS-PAGE loading buffer (50 mM TrisC1 pH 6.8, 2% SDS, 0.1% bromophenol blue, 10% glycerol, 4% β-mercaptoethanol, 1 mM PMSF, 1x Roche cOmplete protease inhibitor cocktail) and boiled for 10 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pancreas was minced into 2- to 3-mm pieces and digested with 0.2 mg/ml collagenase P (Roche) at 37 °C for 10-12 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was tested by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Roche, Mannheim, Germany), according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay (11465007001, Roche Diagnostics, Mannheim, Germany) was performed according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Drug cytotoxicity was evaluated by the colorimetric MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay (Cell Proliferation Kit I, Roche) with a NanoQuant microplate reader (Tecan Trading AG ...
-
bioRxiv - Microbiology 2021Quote: The cytotoxicity assays were performed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Roche, ref:11465007001) protocols according to the previous study [47] with few modifications ...
-
bioRxiv - Biochemistry 2024Quote: Cell metabolic viability was measured by the colorimetric MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Roche). After treatments ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1-3 ng of ChIP DNA with KAPA Library Preparation Kit (KAPA Biosystems) and NimbleGen SeqCap Adaptor Kit A or B (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM 2-Mercaptoethanol and 6 cOmplete EDTA-free protease inhibitor Cocktail tablets (Roche), pH 8.0) ...
-
bioRxiv - Cancer Biology 2022Quote: ... expanded to passage 4 and transfected with RCAS-PDGFB-HA or RCAS-shp53-RFP using a Fugene 6 Transfection kit (Roche, 11814443001). Cells were cultured with DMEM media (Gibco ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mg/ml dispase (Roche) in complete culture media for 15 min at 37 °C ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg sequencing grade trypsin (Roche) was dissolved in 165 μL ice cold trypsin digestion buffer and added to resin in the spin columns with the bottom capped ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 4-minute digestion with proteinase K (Roche, 1:1000 in PBS-DEPC) is followed by probe titration (100-300 ng per slide dependent on the probe ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were then blocked overnight at 4°C in 1 % blocking reagent (Roche) plus 5 % sheep serum in MAB and incubated with anti-DIG conjugated to Peroxidase (1/50 ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were fixed with PFA 4 % and stained with DAPI (Roche; 1:10,000) for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1% (v/v) 2-mercaptoethanol and 60 × 10−3 М n-Octyl-β-D-Glucopyranoside) containing protease inhibitor (Roche). Total protein was collected and incubated with anti-p75NTR (Alomone ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche)) and incubated for 20 min at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets resuspended in LB1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2 supplemented with protease inhibitors [Roche]) for 5 minutes at 4 °C followed by centrifugation (1,000g ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5 % IGEPAL CA-630 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...