Labshake search
Citations for Roche :
501 - 550 of 1109 citations for 6 CHLOROBENZO D ISOXAZOLE 3 CARBONITRILE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and then minced and dissociated in digestion buffer (RPMI containing collagenase (1 mg ml−1 collagenase D; Roche), DNase I (100 μg ml−1 ...
-
bioRxiv - Microbiology 2022Quote: ... and the right inferior lung lobes were digested at 37°C with 630 µg/mL collagenase D (Roche) and 75 U/mL of DNase I (Sigma–Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... The remaining tissue was incubated in digestion buffer (RPMI 1640, 10% FCS, 1.25 mg/ml collagenase D (Roche), 0.85 mg/ml collagenase V (Sigma– Aldrich) ...
-
bioRxiv - Genomics 2019Quote: ... Probes were bound to 2 µg nuclear extracts pre-incubated with 1 µg poly d(I-C) (Roche) or 100-750ng YY1 full-length recombinant protein (31332 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... followed by a 20-min incubation at 37°C in CSS containing 1.5 mg/ml Collagenase D (Roche), 0.6 mM EDTA ...
-
bioRxiv - Immunology 2020Quote: Single cell suspensions of the tumor were obtained after tumor digestion with 400U/mL of collagenase D (Roche) at 37C for 1 hour ...
-
bioRxiv - Cell Biology 2019Quote: ... Fat pads were minced and digested in a solution of collagenase type D (Roche, 11088866001, 1 mg/ml) and Dispase II (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... lung tissue was minced with a scalpel and digested enzymatically with 0.15 WU/mL of D-Liberase (Roche) and 800□U/mL of DNase I (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 10 ml of DMEM media and 1 mg/ml collagenase D (Sigma-Aldrich, COLLD-RO Roche, #11088866001). The tubes were placed on a gentleMACS Dissociator (MACS Miltenyi Biotec ...
-
bioRxiv - Genetics 2021Quote: ... Muscle was then digested in a 15 ml Falcon tube containing 2.4 U/ml Collagenase D (11088882001, Roche), 12 U/ml Dispase II (04942078001 ...
-
bioRxiv - Genomics 2021Quote: ... The concentration of each 10x single cell and V(D)J library was determined through qPCR (Kapa Biosystems) to produce cluster counts appropriate for the NovaSeq 6000 platform ...
-
bioRxiv - Immunology 2021Quote: ... and digested for 20 min at 37 °C in medium supplemented with 1 mg/mL Collagenase D (Roche) and 2000 U/mL DNase I (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... Inguinal stromal-vascular fractions (SVF) were isolated from 2-week-old C57BL/6J mice with collagenase D (Roche) digestion and differentiated as described previously34 ...
-
bioRxiv - Immunology 2022Quote: ... they were digested for 30 minutes at 37°C in PBS 1X containing 1mg/mL Collagenase D (Roche), 100 U/mL DNAse I (Sigma) ...
-
bioRxiv - Microbiology 2022Quote: ... Lamina propria-resident immune cells from large intestine were isolated by digesting intestinal tissue with Collagenase D (Roche), Collagenase V (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... Lungs were perfused with sterile PBS and digested for 1 hour with 625µg/mL collagenase D (Roche 11088875103) and 75U/mL DNase I (Sigma D4527) ...
-
bioRxiv - Immunology 2023Quote: ... the lung was perfused with PBS and digested for 45 minutes with 625μg/mL collagenase D (Roche, 11088875103) and 75U/mL DNase I (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: Histological staining included terminal transferase mediated d-UTP nick end labelling (TUNEL) with Co/Ni enhancement (Roche, UK) performed following manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Cells were isolated from the brain by mechanical disruption followed by collagenase D digestion (Roche Pharmaceuticals, Mannheim, Germany). The resulting cell suspension was resuspended in 40% Percoll (GE Healthcare Biosciences ...
-
bioRxiv - Immunology 2023Quote: Lungs were perfused with sterile PBS and digested for 45 minutes with 625μg/mL collagenase D (Roche 11088875103) and 75U/mL DNase I (Sigma D4527) ...
-
bioRxiv - Microbiology 2024Quote: ... Lactate was quantified using a lactate assay kit (D-Lactic/L-Lactic acid UV method, r-biopharm, Roche). All samples were measured using fresh growth medium as control.
-
bioRxiv - Cancer Biology 2023Quote: Orthotopically implanted syngeneic KPC3 tumor tissues were harvested and digested with 1 mg/mL Collagenase D (Roche, Switzerland) plus with 100 μg/mL DNase I (Roche ...
-
bioRxiv - Bioengineering 2024Quote: ... the infected lungs were transferred to gentleMACSTM C tubes and homogenized on a gentleMACSTM tissue dissociator (“m_lung_01” program) using HEPES buffer (2 mg/ml collagenase D (Roche) and 80 U/mL DNAse I (Roche) ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1-3 ng of ChIP DNA with KAPA Library Preparation Kit (KAPA Biosystems) and NimbleGen SeqCap Adaptor Kit A or B (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Immunology 2023Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Biochemistry 2022Quote: ... The cell pellet collected from 6 L growth was resuspended in 20 mM HEPES (pH 7.8) containing protease inhibitor cocktail (Roche) and DNase I (Sigma) ...
-
bioRxiv - Genomics 2020Quote: ... primers listed in Supplementary Table 6 were used to perform two consecutive PCR reactions with KAPA HiFi polymerase (Roche). Starting from 100 ng of library plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were plated onto collagen-coated plates and transfected at 60-80% confluency using FuGENE 6 (Roche, Indianapolis, IN) according to manufacturer’s instructions ...