Labshake search
Citations for Roche :
601 - 650 of 7700 citations for 6 Bromo 3 N ethylamino 1 2 4 triazolo 4 3 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... embryos were washed (4 X 10 min) in PBTx and blocked in PBT-B (1× PBS, 20% (v/v) western blocking reagent (Roche, 11921673001), 2 mM ribonucleoside vanadyl complex (NEB ...
-
bioRxiv - Pathology 2020Quote: ... Coverslips were incubated overnight at 4 °C with a 1:100 dilution with one of the following primary antibodies: HA (Roche, #867423001), KDEL (Abcam ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... for 3-4 hours at room temperature followed by overnight incubation at 4°C in anti-DIG-AP Fab fragments (1:5000) (Roche 1093274). Embryos were washed with PBST followed by an alkaline tris buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The supernatant was then discarded and the pellet was resuspended in 300 µL SDS buffer (4 % SDS, 10 mM EDTA, 25 mM TrisHCl pH 7.5, 1 mM PMSF, 1x Roche protease inhibitor) and incubated at room temp (10 minutes) ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hours at room temperature and incubated with an appropriate antibody overnight at 4°C: 1:3000 anti-DIG-AP (Roche 11093274910), 1:1000 anti-DIG-POD (Roche 11207733910 ...
-
bioRxiv - Cancer Biology 2022Quote: Engineered monoallelic cell pellets (500 million cells/sample) were lysed at 4°C in 1% CHAPS (Roche Diagnostics, cat no. 10810126001) lysis buffer (pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Physiology 2024Quote: ... the samples were blocked with 5% skim milk in PBS-DEPC for 1 hour at 4°C and incubated with anti-DIG antibody (Roche Diagnostics) diluted 1:10,000 in the blocking buffer for 1 hour at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then incubated overnight at 4°C with a 1:2000 dilution of alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche #11093274910) in MABT blocking buffer with 1% sheep serum ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then incubated overnight at 4°C with a 1:2000 dilution of alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche #11093274910) in MABT blocking buffer with 1% sheep serum ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then pelleted and washed 3 times with PBS containing protease inhibitor (Roche, 11873580001). The pellets were snap-frozen and stored at -80°C for later use ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were lysed at 3 days in ice-cold RIPA buffer containing protease inhibitors (Roche) and protein concentration was determined by BCA Assay (Gibco BRL ...
-
bioRxiv - Genomics 2019Quote: ... beads were washed 3×1mL with bead wash buffer (1x PBS, 5mg/mL BSA, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were then prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Physiology 2023Quote: ... 3 µL of Light Cycler 480 SYBR® Green I Master mix (Roche Diagnostics, Switzerland), 0.24 µL of each primer (10X ...
-
bioRxiv - Genomics 2023Quote: ... For 3-color detection the following antibody dilutions were made: anti-digoxigenin (Roche, cat. 11333089001) 1:10 ...
-
bioRxiv - Developmental Biology 2022Quote: ... AP reaction was developed with 4-Nitro blue tetrazolium chloride (NBT, Roche, 11383213001) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP ...
-
bioRxiv - Plant Biology 2020Quote: ... 4 µg recombinant NAA50 was incubated with 100 µM Acetyl-Coenzyme A (Roche) in a 2X acetylation buffer (50mM Tris HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 mg DNase and one Complete Protease Inhibitor Cocktail Tablet (Roche Diagnostics GmbH). Cells were lysed by the addition of 1% v/w n-dodecyl-β-D-maltopyranoside (DDM ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized by adding 4 units of AMV reverse transcriptase enzyme (Roche) and 0.5 μl 20 pmol/μl of reverse primer labeled with [32P] per reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... 1ml of digestion solution (TM Liberase at 4 units/mL (Roche, Basel, Switzerland) and DNAse Type I at 800 units/mL (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR mastermixes were prepared with 4 μl Light Cycler Enzyme Mix (Roche, Germany), 0.6 μl 10 μM primer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 200 μl/ml of a 4% stock solution of blocking reagent (Roche 11096176001) which was dissolved and autoclaved in MNT solution (150 mM maleic acid pH 7.5 ...
-
bioRxiv - Immunology 2023Quote: ... Macrophages were polarized with 20 ng/mL recombinant IL-4 (Peprotech or Roche) or 100 ng/mL LPS (E ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 mM Sodium Orthovanadate and supplemented with protease inhibitors (Complete protease inhibitors, Roche). After a 20min incubation on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... MEFs were incubated for 4 h with 10 ng/ml colcemid (Roche, 10295892001). Cells were then collected and incubated for 15 min at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 mM EDTA) supplemented with cOmplete Mini EDTA-free protease inhibitor cocktail (Roche). Proteins were resolved on a 4%–12% bis-tris gel (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 4 ng of ChIP DNA with KAPA Library Preparation Kit (KAPA Biosystems) and NimbleGen SeqCap Adaptor Kit A or B (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... AP reaction was developed with 4-Nitro blue tetrazolium chloride (NBT, Roche, 11383213001) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Immunology 2021Quote: ... N-Glycans were released by 10 U N-glycosidase F (Roche) digestion in 50 mM NH4HCO3 buffer pH 8.4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... For N-glycan release 2.5 U N-glycosidase F (Roche, DE) were added and the resulting mixture was incubated overnight at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were then stained overnight at 4°C with pre-absorbed AP-conjugated sheep anti-DIG antibody (1:1000, Roche, cat. 11093274910) in PBS containing 0.1% Triton X-100 and 20% horse serum ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were incubated alone or with ipICP4/pICP4 or BSA for 1 h at 4°C and subsequently fluorescence intensity was measured in a LightCycler II (Roche, Milan, Italy) by observing 6-carboxyfluorescein (6-FAM ...
-
bioRxiv - Genetics 2020Quote: ... Proteins were separated by SDS-PAGE on 4-12% Bis-TRIS SDS-polyacrylamide gels (Novex, NP0322BOX) and analysis was done against primary antibodies α-HA (1:1000, Roche, 12CA5) or α-Tub2 (1:4500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were incubated overnight at 4°C in Odyssey blocking buffer containing 0.1% Tween-20 at 4°C and 1/1000 dilution of anti-c-myc mouse monoclonal antibody (Catalogue number 11 667 149 007, Roche, Bâle, Switzerland) or anti-β-tubulin mouse antibody (Catalogue number T9026 ...
-
bioRxiv - Cell Biology 2024Quote: ... the full-length Treacle was amplified by PCR from cDNA with primer set #4 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BglII and BamHI sites respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6 µl of MNase (1 mg/ml; Nuclease S7, Roche) was added to the lysate ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...