Labshake search
Citations for Roche :
351 - 400 of 7931 citations for 6 Bromo 3 3H imidazol 4 ylmethylene 1 3 dihydro indol 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... DNA Standards 1-6 (KAPA Biosystems KK4903). Libraries were pooled based on equal molar amounts to 1.9nM for multiplexed sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA Standards 1-6 (KAPA Biosystems KK4903). The libraries were pooled based on equal molar amounts to 1.85 nM for multiplexed sequencing.
-
bioRxiv - Molecular Biology 2020Quote: ... plasmid DNA from the in vitro methylation reactions were transfected with 3 µL (Il33) or 1 µL (SV40) X-tremeGENE 9 transfection reagent (Roche) diluted in 50 µL of Opti-MEM medium (Gibco) ...
-
bioRxiv - Microbiology 2019Quote: ... The membranes were then probed for 16 h at 4 °C with the following primary antibodies in 3% (w/v) skim milk in PBS: mouse anti-GFP (1:1000, Roche), rabbit anti-SBP1 (1:1000 ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 mM sodium phosphate pH 8.0, 3% glycerol, 1% Triton X-100, 15 mM imidazole, and 1x protease inhibitor [Roche, Sigma]) and sonicated ...
-
bioRxiv - Neuroscience 2021Quote: ... and PI) and de-glycosylated for 3 h at 37 °C with 1 unit of PNGase-F (Roche Applied Science) added per 10 μl volume ...
-
bioRxiv - Cancer Biology 2020Quote: ... Exon 1 and exon 3 digestion products were purified using the High pure PCR product purification kit (Roche, Basel, Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) (pH 8.0) and the presence of Complete® protease inhibitor (Roche). The preparation was centrifuged for 10 min at 2500 rpm and 4 °C and supernatant was transferred to a new tube and centrifuged for 40 min at 30,000 x g and 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The lymphocytes from the immunized mice were fused with myeloma P3U1 cells at a ratio of 3:1 by mixing in 50% polyethylene glycol (Roche). The fused cells were dispersed in 80 ml of GIT medium (Wako ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were diluted 1:3 in ddH2O on ice in a 45 μL total volume before analysis in the Cobas c111 Analyzer (Roche). The Cobas c111 Analyzer is a platform for clinical chemistry testing of human samples but it can also be used to analyze mouse samples ...
-
bioRxiv - Immunology 2023Quote: ... the common bile duct was clamped and the pancreatic duct was perfused with 3-5 mL solution of collagenase P in HBSS-1% HEPES (Roche). The pancreas was then harvested and transferred to a 50mL conical tube containing 5mL of collagenase P solution and kept on ice until all organs were collected ...
-
bioRxiv - Neuroscience 2023Quote: ... Washes were followed by blocking in 10% heat-inactivated sheep serum for 1-3 hours and incubation in buffer containing sheep antidigoxigenin antibody (Roche) at 1:5000 dilution for 16-20 hours at 4oC ...
-
bioRxiv - Cell Biology 2022Quote: ... The HEK 293T cells were mixed with 1 μg of mouse Ano9 cDNA (mAno9-pEGFP-N1) and 3 μl FuGene HD (Roche Diagnostics). The transfected cells were plated onto glass coverslips that were kept in a 35-mm round Petri dish ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... Coverslips were blocked in 3% BSA (wt/vol) and digoxigenin was detected with sheep anti-digoxigenin FITC 1/50 (Roche, 11207741910) followed by rabbit anti–sheep FITC 1/100 (Vector Laboratories ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each eluate (3 µl) was subjected to PCR amplification in 50-μl reactions containing 1 KAPA HiFi HotStart Uracil+ReadyMix (Kapa Biosystems) and 0.3 μM Dual Index primers of NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 5-bromo4-chloro-3-indolyl phosphate toludinium (Roche Diagnostics, Cat. No 11383221001). Images were taken on a Zeiss Axio Compound Light Microscope with Optronics MacroFire Digital Camera.
-
bioRxiv - Developmental Biology 2021Quote: ... 3 % SDS with protease inhibitors (cOmplete Mini EDTA-free Protease Inhibitor Cocktail, Roche) at room temperature for 1 hour in a total volume of 3 mL ...
-
bioRxiv - Cell Biology 2022Quote: ... collected in a 1.5 ml tube and blocked overnight in 3% BSA (Roche) before incubating in primary antibody (3% BSA in PBT ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from 3 million HEK293T?cells using TriPure reagent (Roche) and purified using RNeasy MinElute Cleanup Kit (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ and 3’ linkers were terminally labelled with digoxigenin-11-dUTP (Roche) or biotin-16-dUTP (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 with with 2X cOmplete Protease Inhibitor Cocktail EDTA-free (Roche)) for 8 minutes ...
-
bioRxiv - Biophysics 2019Quote: ... Following re-suspension in 3 ml of medium containing protease inhibitor (Roche Diagnostics), the cells were cracked open using a ball bearing homogenizer with a 0.2507-inch bore and 0.2496-inch diameter ball ...
-
bioRxiv - Immunology 2019Quote: ... Single-cell suspensions of lung cells were prepared by Liberase Blendzyme 3 (Roche) digestion of perfused lungs as previously described48 ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted by digesting the RNA with 3 µg RNase A (Roche) and 30U RNase T1 (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.2% bromophenol blue) and treated with 3 mg/ml Proteinase K (Roche) for 1 h at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Each sample was subject to 3 rounds of homogenisation using a MagnaLyser (Roche) at 6,000 rpm for 15 seconds ...
-
bioRxiv - Molecular Biology 2022Quote: ... Poly-guanine was added at the cDNAs 3’ end using Terminal Transferase (Roche) and dGTPs ...
-
bioRxiv - Biophysics 2022Quote: GGCAGCGCTACCATAACGGA-3’) (11) by RT-qPCR was performed using LightCycler 480 II (Roche). GAPDH mRNAs were used as a loading control (14) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Developmental Biology 2023Quote: ... After a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 (Roche), trypsin B (BI) ...
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... Cells were then lysed by sonication 6 times for 15 sec each in one of the following buffers each containing the Protease Inhibitors Cocktail tablets (Roche) and 1 mg/mL lysozyme (L6876 ...
-
bioRxiv - Microbiology 2022Quote: ... one of which was treated with 2 U of PNGase F (Roche Cat. Nr. 11365177001) at 37 °C for 1 hour ...
-
bioRxiv - Biophysics 2023Quote: ... 2 mM PMSF) supplemented with one protease inhibitor cocktail tablet (cOmplete-EDTA free, Roche, #11836170001) to a final volume of 50 mL ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μl of 2× KAPA HiFi HotStart ReadyMix (KAPA Biosystems, Wilmington, Washington, USA), 1.4 μl of each primer (2.5 μM) ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% BSA/TBS-T) at 4°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5% Normal Goat Serum) for 3 h at room temperature and then incubated overnight with alkaline phosphatase-conjugated anti-DIG Fab fragments (Roche, 1: 2,000) at 4°C on a shaking platform ...
-
bioRxiv - Neuroscience 2020Quote: ... 1996) on 16 µm cryosections at post-natal day 3 (P3) using anti-digoxigenin antibody (Sheep polyclonal, 1:1000, Roche, 11093274910, RRID:AB_514497). Two days exposure to alkaline phosphatase (AP ...
-
bioRxiv - Physiology 2021Quote: ... a 6.7 kb DNA fragment starting 1 kb upstream of murine Gnrhr exon 3 was amplified by PCR using the Expand Long Template PCR System (Roche, Basel, Switzerland) from 129SvEv genomic DNA using primers incorporating 5’ XmaI and 3’ NotI restriction enzyme sites (Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were lysed in 50 µl of lysis buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1× Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were incubated in 0.5 mg/ml nitroblue tetrazolium and 0.19 mg/ml bromo-chloroindolylphosphate (Roche) in 100 mM Tris-HCl ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...