Labshake search
Citations for Roche :
651 - 700 of 8155 citations for 6 AMINO 4H 7H 1 3 DITHIINO 5 4 D PYRIMIDIN 8 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: Cells were lysed in TNT buffer (1% Triton X-100, 150 mM NaCl, 50 mM Tris HCl, pH 8) with protease inhibitors (Roche). 5 uL of whole cell lysate (approximately 40 μg ...
-
bioRxiv - Biochemistry 2019Quote: ... The cells were then pelleted again and resuspended in 150 μL of Lysozyme buffer (150 mM NaCl, 30 mM Tris–HCl pH 8, 10 mM EDTA, 1 mM TCEP, cOmplete protease inhibitor (Roche), 1 mg/ml lysozyme ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were harvested 48h after transfection and lysed in lysis buffer (50mM Tris-Cl pH 8, 150mM NaCl, 1% Triton, 1x Roche Complete Mini Protease Inhibitor Cocktail ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were washed twice with PBS and lysed with 6 ml of lysis buffer (8 M urea, 150 mM NaCl, 100 mM ammonium bicarbonate, pH 8; added per 10 ml of buffer: 1 tablet of Roche mini-complete protease inhibitor EDTA free and 1 tablet of Roche PhosSTOP tablet ...
-
bioRxiv - Microbiology 2022Quote: ... cells were recovered and lysed in 500 µl hypotonic lysis buffer (10 mM Tris-HCl pH 8, 10 mM KCl, 1× complete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cell Biology 2022Quote: ... collected and lysed with NP-40 extract buffer (50 mM Tris, pH 8, 150 mM NaCl, 1 % NP-40) containing protease inhibitors (#11873580001 Roche) and 30 µg of lysate was migrated in 10 % SDS-PAGE gels (Bio-Rad Laboratories) ...
-
bioRxiv - Plant Biology 2021Quote: ... For IPs 0.3 g of flower buds were ground in 1.5 ml of ice-cold lysis buffer (50 mM Tris-HCl pH 8, 50 mM NaCl, 1 % Triton X-100, supplemented with Roche cOmplete ...
-
bioRxiv - Microbiology 2020Quote: ... pelleted and resuspended in 150 μl sonication buffer [(50 mM Tris pH 8, 1% SDS, 10 mM EDTA, 1x protease inhibitor (Roche)] ...
-
bioRxiv - Developmental Biology 2020Quote: ... Nuclei were pelleted by centrifugation and resuspended in sonication buffer (50 mM Tris-HCl pH 8, 1% SDS, 10 mM EDTA, 1x cOmplete ULTRA Tablet (Roche)) and sonicated using a Bioruptor sonicator (Diagenode ...
-
bioRxiv - Genetics 2019Quote: ... cells were vortexed and passed through a syringe in ubiquitin lysis buffer (2% SDS, 150mM NaCl, 10 mM Tris HCl pH 8, 1 Roche protease inhibitor tablet ...
-
bioRxiv - Genetics 2021Quote: ... Probes were generated using primers listed in Supplementary Table 1 from the G135P65476A4 BAC as described in [8] and were labeled using the DIG-Nick Translation Mix (Roche) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1 mM EDTA at pH 8, 10% glycerol, 1 mM DTT, 0.5 mM PMSF, 0.1 mM sodium orthovanadate, and 1X Roche protease inhibitors). Collected nuclear pellets were lysed in in 1× RIPA buffer (10 mM Tris-Cl at pH 8.0 ...
-
bioRxiv - Cell Biology 2019Quote: ... The qPCR reaction was carried out in 8 μl with a primer concentration of 1 μM and SYBR Green Master mix (Roche) in a Roche LightCycler 480 system ...
-
bioRxiv - Plant Biology 2022Quote: ... then ground in 500 μl freshly prepared lysis buffer (25 mM Tris HCl pH 8, 150 mM NaCl, 1% SDS, 1x cOmplete ULTRA protease inhibitor (Roche), and 1x PhosSTOP (Roche)) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were incubated with 8-keto-NeuAc derivatives for 24 h and proliferation measured using WST-1 (Roche Applied Science) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were washed with ice-cold PBS and scraped into lysis buffer (1 mM EPPS, 8 M urea, protease (complete mini, EDTA-free) inhibitors (Roche) and PhosSTOP phosphatase inhibitor (Roche)) ...
-
bioRxiv - Plant Biology 2022Quote: ... the supernatant was centrifuged at 20000 g for 30 min at 4°C and the resulting pellet was solubilized with lysis buffer (20 mM Tris–HCl pH 8, 150 mM NaCl, 1% TritonX100, Complete EDTA-free Protease Inhibitor cocktail (Roche), PhosSTOP phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... Five volumes of 50 mM Tris pH 8 was added and proteins were digested over night with trypsin (1:50) (Roche) at 37°C while shaking at 800 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... were lysed by sonication in ∼140 mL lysis buffer (50 mM Tris-HCl pH 8, 250 mM KCl, 1 mM TCEP) supplemented with protease inhibitor cocktail (Roche) and DNase I (5 μg/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... Thawed cells were resuspended in solubilization buffer (20 mM HEPES pH 8, 500 mM NaCl, 2 mM MgCl2, 15% glycerol, 1 Roche EDTA free Protease inhibitor tablet ...
-
bioRxiv - Biochemistry 2023Quote: ... The pellet was resuspended in 30 mL of 40 mM Tris pH 8 supplemented with 1 tablet of EDTA-free protease inhibitor tablet (Roche), and 0.1 mM PMSF ...
-
bioRxiv - Molecular Biology 2023Quote: ... Frozen cell pellets were resuspended in 300 μL of cold hypotonic buffer (10 mM Tris-HCl pH 8, 1.5 mM MgCl2, 1 mM KCl, 10X PhosphoSTOP (Roche, 4906845001), 2X Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... and twice with TE wash buffer (10 mM Tris-HCl pH 8, 1 mM EDTA, 1x Roche protease inhibitor mixture).
-
bioRxiv - Immunology 2023Quote: ... The cell pellets were treated with lysis buffer (50 µg/mL digitonin, 75 mM NaCl, 1 mM NaH2PO4, 8 mM Na2HPO4, 250 mM sucrose, and Roche cOmpleteTM protease inhibitor cocktail ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were disrupted in 1% NP-40 lysis buffer (140 mM NaCl, 10 mM Tris-HCl pH 8, 1% NP-40) supplemented with proteinase inhibitors (Roche). Proteins were separated by electrophoresis (SDS-PAGE) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The final pellet was resuspended in 750 uL nuclear lysis buffer (10 mM EDTA, 1% SDS, 50 mM Tris-HCl at pH 8, 1x cOmplete protease inhibitor cocktails (Roche)) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and D (2.4 mg/ml, Roche) for 12h at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... then digested with Collagenase D (Roche) at 37 C for 30 minutes ...
-
bioRxiv - Immunology 2019Quote: ... 0.37 U/ml Collagenase D (Roche), 10 μg/ml DNaseI (Roche ...
-
bioRxiv - Immunology 2020Quote: ... 2 mg/ml collagenase D (Roche), and 1.5 mg/ml DNase I (Roche ...
-
bioRxiv - Immunology 2021Quote: ... and collagenase D (1mg/mL; Roche). Cortices were removed by first bisecting the brain along the sagittal plane to expose the corpus callosum ...
-
The transcription factor RUNX2 drives the generation of human NK cells and promotes tissue residencybioRxiv - Immunology 2022Quote: ... collagenase D (2 mg/mL, Roche) and Dnase I (0.2 mg/mL ...
-
bioRxiv - Immunology 2019Quote: ... 500 U/ml collagenase D (Roche), and 20 ug/ml DNAse I (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... Collagenase D was obtained from Roche, Germany ...
-
bioRxiv - Genomics 2020Quote: ... collagenase D (1.5 units/ml; Roche), and dispase II (2.4 units/ml ...
-
bioRxiv - Immunology 2021Quote: ... 0.625 mg/ml Collagenase D (Roche), 1 mg/ml Dispase (Gibco) ...
-
bioRxiv - Immunology 2020Quote: ... 2mg/ml collagenase D (Roche, US), 1mg/ml dispase and 1mg/ml of DNase (both from Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... + 400 U/ml Collagenase D (Roche) + 2.5 U/ml Dispase (Corning ...
-
bioRxiv - Immunology 2023Quote: ... and 0.5mg/mL collagenase D (Roche). Cell suspensions were then filtered using 40μm cell strainers ...
-
bioRxiv - Immunology 2023Quote: ... and 10U/ml collagenase D (Roche) in complete RPMI (cRPMI) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.2 mg/ml Collagenase D (Roche) in RPMI 1640 (Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1mg/mL Collagenase D (11088858001, Roche), and 1U/uL of RNAse inhibitor (RiboLock RNAse Inhibitor ...
-
bioRxiv - Immunology 2024Quote: ... 320 U/mL Collagenase D (Roche), and 50 ug/mL DNase I (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... one volume of 2X TBS buffer supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche Applied Science) was added to one volume of packed worms then added dropwise to liquid N2 to obtain frozen worm ‘popcorn’ ...
-
bioRxiv - Microbiology 2023Quote: ... one half was immunoblotted with NB13 (7 µg/mL) followed by washing and probing with α-HA-peroxidase (1:1000, Roche), whereas the other half was probed with α-His-peroxidase only (1:4000 ...
-
bioRxiv - Molecular Biology 2019Quote: pLKO.1 lentiviral construct along with packaging vector ΔVPR and VSVG plasmids were transfected using Fugene-6 (Roche) or PEI (POLYSCIENCES 23966-2 ...
-
bioRxiv - Microbiology 2022Quote: Prior to quantitative amino acid analysis Cel1cat was de-glycosylated using EndoH (Roche Diagnostics GmbH). The de-glycosylation was carried out in 20 mM MES ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 8% PFA in PBS supplemented with phosSTOP (Roche) for 1 hour at 4°C ...