Labshake search
Citations for Roche :
501 - 550 of 6252 citations for 6 9 DIMETHOXY PHENAZINE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was extracted using the column-based High Pure Viral Nucleic Acid Kit (Roche, Basel, Switzerland), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 40% isopropanol) and DNA was purified using a High Pure Viral Nucleic Acid kit (Roche Life Science) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Fatty acid-free bovine serum albumin (BSA) and Complete Protease Inhibitor cocktail tablets were procured from Roche Diagnostics (Laval ...
-
bioRxiv - Cancer Biology 2022Quote: ... Isolated adipocytes were cultured in DMEM: F12 media supplemented with 0.1% fatty acid free BSA (Roche, NY), 100 U/ml penicillin ...
-
bioRxiv - Genomics 2022Quote: ... The extra-viral nucleic acids were then degraded with 100 U/mL DNase (Roche, Cat. No. 10104159001) for 1 h on the bench top ...
-
bioRxiv - Pathology 2023Quote: ... After addition of 4% sodium phosphotungstic acid in 170 mM MgCl2 and protease inhibitors (Complete-TM, Roche), extracts were incubated at 37 °C for 30 minutes and centrifuged at 18,000 x g for 30 minutes at 25 °C ...
-
bioRxiv - Zoology 2023Quote: Automated nucleic acid extraction from samples was performed using Magnetic Particle Processors (MagMax, KingFisher, Roche and others) and appropriate kits ...
-
bioRxiv - Immunology 2022Quote: ... and pLenti-Luc-GFP (6 µg) into HEK293T cells using X tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer′s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... The Th17 cultured cells were stimulated in presence of IL-6 (20ng/ml, Roche, Cat# 11138600 001); IL-1β (10ng/ml ...
-
bioRxiv - Immunology 2020Quote: ... brains were cut into 6 pieces and incubated in 5 mL HBSS containing 50U/mL DNase (Roche), and 4U/mL papain (Worthington-Biochem ...
-
bioRxiv - Microbiology 2019Quote: ... were transfected with 20 ng pNF-□B-Luc and 3 ng pRL-TK using FuGENE 6 (Roche). Transfected cells were incubated for 24 h (37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Vector DNA was transiently transfected into human embryonic kidney (HEK) cells using Fugene-6 (Roche Molecular Biochemicals) transfection reagent ...
-
bioRxiv - Immunology 2023Quote: ... Serum IL-6 and CRP levels were measured using in vitro diagnostic methods validated at PPD (Roche Cobas ...
-
bioRxiv - Genomics 2019Quote: ... 2015) that uses the tube assemblies from the High Pure Viral Nucleic Acid Large Volume kit (Roche, 05114403001). The intact ossicles were placed in the extraction buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... membranes were blocked with 10 mL of 1x blocking solution diluted in 1x Maleic Acid Buffer (Roche, 115857262001) with 0.3% TWEEN 20 for 30 minutes at room temperature ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total nucleic acids were purified from nasopharyngeal swab samples using a MagNA Pure 96 System (Roche Applied Sciences). All samples were treated with DNase I (Promega ...
-
bioRxiv - Plant Biology 2023Quote: ... Hybridization and probe detection was performed using a DIG Luminescent Detection Kit for Nucleic Acids (Roche Diagnostics, UK) as per the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: ... Nucleic acids were UV-crosslinked to the membrane and incubated with prehybridization buffer DIG Easy Hyb (11603558001, Roche,) in a hybridization tube at 37° C for 30 min with rotation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Nucleic acid precipitation was carried on ice in HisA supplemented with 1M LiCl and cOmplete protease inhibitor (Roche) for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The nucleic acid pellet was resuspended TE buffer and treated with 0.05 µg/µL RNase (Roche Cat# 11119915001) for >15 hr at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... they were purified in large volume columns using the High Pure Viral Nucleic Acid Large Volume Kit (Roche) with 2.5 mL of PB buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Lactate was quantified using a lactate assay kit (D-Lactic/L-Lactic acid UV method, r-biopharm, Roche). All samples were measured using fresh growth medium as control.
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with siRNAs or plasmid DNAs using Dharmafect 4 (Dharmacon) or Fugene 6 (Roche Applied Sciences) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were seeded in 10 cm tissue-culture treated dishes and transfected with FuGENE 6® reagent (Roche) for 24 hr ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... After incubating in primary antibodies for two hours and DAPI (4′,6-diamidine-2′-phenylindole dihydrochloride, Sigma Aldrich, 10,236,276,001 Roche) for the last ten minutes ...
-
bioRxiv - Biochemistry 2022Quote: (His)6-GST-SNX15 MIT was bound to cOmplete His-Tag purification beads (5 mL, Roche, Germany, 2h) and washed with 2 L wash buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... the samples were incubated with 4′,6-diamidino-2-phenylindole (DAPI; F. Hoffmann-La Roche, Natley, NJ, USA) and appropriate donkey anti-mouse/rabbit/rat/chicken secondary antibodies conjugated to Alexa Fluor 488 ...
-
bioRxiv - Neuroscience 2022Quote: ... hDAT and Stx1 constructs were transiently cotransfected into these cells (hDAT cells) using Fugene-6 (Roche Molecular Biochemicals) per the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... The mini-genes in the pSPL3b vector were transiently transfected using 6µl of FuGENE 6 Transfection Reagent (Roche) with 2 µg of vector ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... five pupae were homogenized in 100uL of homogenization buffer (125 mM Tris pH 6.8, 6% SDS, 2.5X Roche cOmplete protease inhibitor cocktail ...
-
bioRxiv - Neuroscience 2023Quote: ... Vectors were co-transfected with packaging-defective helper plasmids into 293T cells using Fugene 6 transfection reagent (Roche). Fibroblasts were plated at a density of 50,000 cells/well on 0.1% gelatin-coated 6-well plates and infected three times with a viral cocktail containing vectors expressing OCT4:SOX2:KLF4:cMYC in a 2:1:1:1 ratio in the presence of 6 µg/ml protamine sulfate (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant containing chromatin fragments was then treated with 6-10 µg/g cells DNase-free RNase (Roche) at 37°C for 30 minutes and subsequently cleared by centrifugation at 30,000 rcf for 30 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Both were fragmented at 94°C for 6 min and ligated with KAPA Unique Dual-Indexed adaptors (Roche). Library quality was checked on an AATI (now Agilent ...
-
bioRxiv - Biochemistry 2024Quote: ... an additional 6-cycle PCR was carried out with the HiFi HotStart Ready Mix (Kapa Biosystems, Wilmington, MA) and primers that preserve the DNA sequence ...
-
bioRxiv - Physiology 2019Quote: ... Free fatty acid and triglyceride levels were measured in serum using the colorimetric quantification kits Half-micro test (Roche) and Infinity (ThermoScientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The radiolabeled nucleic acid was recovered by gel-filtration using a Sephadex G-50 fine Quick Spin column (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) and protease inhibitor cocktail (Roche) on ice for 20 min ...
-
bioRxiv - Genetics 2019Quote: ... Next embryos were washed in blocking solution (100mM maleic acid, 150 mM NaCl pH 7.5, 2% blocking reagent (Roche)) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from clinical isolates using the AMPLICOR® Respiratory Specimen Preparation Kit (Roche, Basel, Switzerland) and purified with 1.8X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... in homogenization buffer (320mM sucrose, 5mM sodium pyrophosphate, 1mM EDTA, 10mM HEPES pH 7.4, 200nM okadaic acid, protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Physiology 2021Quote: ... Trypsin activity was then inhibited by adding to the homogenate bovine serum albumin (BSA) fatty acid free (0.25 mg/mL) and protease inhibitor cocktail (PIC, Roche).
-
bioRxiv - Biophysics 2022Quote: ... either 10 μl of vehicle or 10 μl of S1P at different concentrations in 0.5 %w/v fatty acid-free BSA (10775835001, Roche) solution in PBS was added ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were washed twice in phosphate buffer saline and resuspended in 7H9 base media + 0.05% tyloxapol + 0.085% NaCl containing either 5g/L or 50g/L of fatty acid free BSA (fraction V Roche) with no glycerol nor dextrose added ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... The absence of kit/reagent contamination was verified in the High Pure Viral Nucleic Acid Kit (Roche Applied Science) and Illustra™ GenomiPhi V2 DNA Amplification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Microbiology 2023Quote: ... titrated to pH 8.1 with phosphoric acid) with protease and phosphatase inhibitors added (Roche, CO-RO and PHOSS-RO) and sonicated ...
-
bioRxiv - Molecular Biology 2023Quote: ... in complementary deoxyribonucleic acid (cDNA) from 10 ng total RNA in 10 μl reactions with 2× Master Mix (Roche) in a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... The cell pellet collected from 6 L growth was resuspended in 20 mM HEPES (pH 7.8) containing protease inhibitor cocktail (Roche) and DNase I (Sigma) ...