Labshake search
Citations for Roche :
101 - 150 of 8496 citations for 6 4 METHOXY PHENYL 3 METHYL IMIDAZO 2 1 B THIAZOLE 5 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM 2-Mercaptoethanol and 6 cOmplete EDTA-free protease inhibitor Cocktail tablets (Roche), pH 8.0) ...
-
bioRxiv - Microbiology 2020Quote: ... G355-5 cells were transfected with 1 to 6 µg DNA in 6 cm dishes using X-treameGENE 9 (Roche, Basel, Switzerland). The 293T/17 cell line was obtained from ATCC (CRL-11268 ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissue was transferred to a 50 mL conical tube and resuspended in DPBS/BSA containing collagenase B (2-4 mg/mL) (Roche, Mannheim, Germany) and DNase I (2,000 U/mL ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Neuroscience 2023Quote: ... diluted in PBS for 2 hours at room temperature after which they were counterstained with 300 nM 4’,6’-diamino-2-phenylindole (DAPI; 10236276001, Roche) for 5 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... and then reacted with 0.375 mg/mL nitroblue tetrazolium and 0.188 mg/mL 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP; Roche Diagnostics) for 27—42 h.
-
bioRxiv - Plant Biology 2021Quote: ... in paraffin-embedded sections (8µm) and color was detected with 5-bromo-4-chloroindol-3-yl phosphate/nitrateblue tetrazolium (BCIP/NBT) (Roche).
-
bioRxiv - Genetics 2021Quote: ... 6-diamidino-2-phenylindole (Hoechst; Roche, Rotkreuz, Switzerland) for nuclei ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hearts were cut into 1–2 mm3 pieces and incubated with 0.5 U/mL collagenase B (Roche #11088807001) in 0.2% NaN3/PBS and left to oscillate at 1000 rpm at 37 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... lumbar vertebrae 1 – 5 were incubated in 2% Collagenase P (Roche, Switzerland) for 30 minutes at 30° C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene expression signals were visualized using nitroblue tetrazolium/5-bromo-4-chloro-3-indolylphosphate solutions using a standard method (Roche). Whole-mount and sectioned specimens of Ciona were observed using an SZX12 stereo microscope (Olympus ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by visualization with nitro blue tetrazolium and 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) (Roche Diagnostics, Basel, Switzerland). Embryos were imaged using a Leica M205 FA epifluorescence microscope (Leica ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were subsequently incubated in the dark on a slow rocker in dilutions of Nitro-blue tetrazolium/5-bromo-4-chloro-3-inodyl phosphate (NBT/BCIP; Roche) in TBST ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of DIG-probes was made in staining buffer (in 10% polyvinyl alcohol) supplemented with nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate (BCIP) (Roche). In addition ...
-
bioRxiv - Genetics 2022Quote: ... Expression patterns were visualized with a Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3-Indolyphosphate p-Toluidine Salt (NBT/BCIP) system (Roche). Sections were mounted with Vectamount (Vector laboratories ...
-
bioRxiv - Developmental Biology 2019Quote: ... and then incubated at room temperature in the same solution containing NBT-BCIP (nitrotetrazolium blue chloride at 350 µg/ml and 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt at 175 µg/ml) (Roche) until the color appeared ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1% Tween 20 in water) and incubated in NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) solution (Roche).
-
bioRxiv - Microbiology 2022Quote: ... The membrane was washed again with 1x TBST 3-5 times for a total of 20 min and developed using 5-bromo-4-chloro-3-indolylphosphate (BCIP)/ nitro-blue tetrazolium (NBT) (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Hybridised probes were detected with anti-DIG antibodies and revealed with alkaline phosphatase-conjugated antibodies in presence of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Roche).
-
bioRxiv - Neuroscience 2022Quote: ... Alkaline phosphate labeling was detected by incubation overnight at room temperature in the dark with a nitroblue tetrazolium plus 5-bromo-4-chloro-3 indolyl-phosphate mixture (Roche) with levamisole (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... slides were incubated at 37oC in a staining solution containing nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche) for 20-24 hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.1% Tween 20 in water) and incubated in NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) solution (Roche).
-
bioRxiv - Pathology 2023Quote: ... Bound alkaline phosphatase was visualized with nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP; 11681451001, Roche). The reaction was stopped by incubation in buffer 4 (10 mM Tris and 1 mM EDTA ...
-
bioRxiv - Biophysics 2021Quote: ... transient transfection was performed with a total of 1 µg of plasmids (EGFRmCitrine, PTBmCherry and cCblBF P at ratio 4:3:4 by mass) using FUGENE6 (Roche Diagnostics) transfection reagent and Opti-MEM (Gibco - Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 30 mM mgCl2 x 6 H2O and 5 mg/mL glucose-6-phosphate dehydrogenase (Roche Diagnostics) in 0.1 M potassium phosphate buffer pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... 5% b-ME) supplemented with protease and phosphatase inhibitors (Roche/Sigma-Aldrich). A Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 1 mM ATP, 1% IGEPAL, 5% glycerol, 3 U/ml Benzonase and Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 million cells were pre-extracted on ice with ice-cold 30 µl CSK buffer (25 mM HEPES pH 7.4, 50 mM NaCl, 1 mM EDTA, 3 mM MgCl2, 300 mM sucrose, 0.2% Triton X-100, 1 Roche cOmplete protease inhibitor cocktail tablet per 50 ml of buffer ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... and developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indoxyl phosphate (BCIP; Roche, Switzerland) for 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... and then the detection reaction was carried out in a buffer containing 3.5 µl/ml of of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Bâle, Switzerland). The reaction was stopped with 50 mM EDTA in PBS and embryos were washed in PBSTw ...
-
bioRxiv - Neuroscience 2023Quote: ... The hybridization signal was revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 in a proportion of 0.45 µl of NBT and 4.5 µl of BCIP in 5 ml of B2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were washed and detection was performed at pH 9.5 by incubating in nitro blue tetrazolium and 5-bromo-4-cholro-2-indoyl phosphate solution (Roche) as per manufacturer instructions ...
-
bioRxiv - Biophysics 2022Quote: ... embryos were washed (4 X 10 min) in PBTx and blocked in PBT-B (1× PBS, 20% (v/v) western blocking reagent (Roche, 11921673001), 2 mM ribonucleoside vanadyl complex (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were washed and the secondary antibodies applied (dilutions listed below) with 4′-6-diamidino-2-phenylindole (DAPI: Cat # 10-236-276-001, Roche Diagnostics, Indianapolis, IN) at 1:1,000 for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Genomics 2022Quote: ... and 1 mg/mL Collagenase B (Roche, #11088815001) supplemented with 5 mM MgCl2 and 2% penicillin–streptavidin (Gibco ...
-
bioRxiv - Genomics 2022Quote: ... and 1 mg/mL Collagenase B (Roche, #11088815001) supplemented with 5 mM MgCl2 and 2% penicillin–streptavidin (Gibco ...
-
bioRxiv - Immunology 2019Quote: ... memory B cells were plated at 6 B cells in 55 μl per well into 96 × 384-well plates in B cell media supplemented with 100 U ml−1 IL-2 (Roche), 50 ng ml−1 IL-21 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... 18.75 mg/ml nitro blue tetrazolium chloride, 9.4 mg/ml 5-bromo-4-chloro-3-indolyl phosphate toluidine salt in 67% dimethyl sulfoxide, Roche; Cat. No. 1681451) was added to the third change of NDB while stirring thoroughly until completely dissolved ...
-
bioRxiv - Neuroscience 2020Quote: ... the signal was visualized by incubation with nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolylphosphate (BCIP) solution (Roche Diagnostics, 11681451001) in 0.1 M Tris-HCl (pH9.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Bioengineering 2020Quote: ... Hela cells were plated one day before in 6-well plate at 50% confluency and transfected with 1 μg plasmid and 3 μl XtremeGeneHP transfection reagent (Roche) during 24 hours ...