Labshake search
Citations for Roche :
501 - 550 of 1300 citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... 5 mM beta-mercaptoethanol (BME)) with protease inhibitors (cOmplete™ EDTA-free, Roche, Indianapolis, IN). Lysozyme (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... A 5% Triton X-100 solution with 1x protease inhibitors (Roche Complete Mini, EDTA free) was added 1:1 to a 50 μl worm pellet ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by PCR amplification with EcoRI-CEP131-5’ (ACCGAGAATTCCATGAAAGGCACCCGGGC) using KAPA HiFi DNA polymerase (Roche). The product was digested with EcoRI and BamHI and ligated into similarly digested pEGFP-C1 (Clontech) ...
-
bioRxiv - Neuroscience 2021Quote: ... S.p.a) and midazolam (0,5 mg kg −1) (Dormicum®, 5 mg/ml, Roche Pharma, Switzerland) for IM premedication before the start of the procedure ...
-
bioRxiv - Biophysics 2020Quote: ... 5 mM MgCl2 (buffer B) containing 2 mM PMSF and Complete protease inhibitor cocktail (Roche). After centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were counterstained with 5 ng/ml of 4,6–diamidino-2-phenylindole dihydrochloride (DAPI; Roche). Coverslips were mounted on slides with Fluoromount G (Electron Microscopy Sciences ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Cell Biology 2021Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained testicular explants were embedded in gelatin ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then blocked in PBT 0.2% with 5% bovine serum albumin (Roche, Cat# 10735094001) before staining with primary antibodies overnight at 4 °C ...
-
bioRxiv - Physiology 2022Quote: ... 5 μL KAPA SYBR® FAST Master Mix (2X) Universal (Kapa Biosystems Inc., MA, USA), and 100 nM of gene-specific primers ...
-
bioRxiv - Plant Biology 2022Quote: ... and immunoprecipitated with 5 μg Mouse monoclonal anti-GFP antibody (clone 9E10, IgG, Roche, Switzerland). About 200∼300 bp of ChIP DNA and input DNA were recovered and dissolved in water for further qPCR analysis [82] ...
-
bioRxiv - Plant Biology 2022Quote: ... The 5’-end biotin probes were generated using a DIG Gel Shift Kit (Roche, China) (Supplemental Table S8) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM EDTA pH 8.0) supplemented with protease inhibitors (cOmplete Protease Inhibitor Cocktail, Roche, 11697498001) and lysed by vortexing at 4 °C for 15 minutes.™ Cell debris was pelleted by spinning at 21000 RCF at 4 °C for 15 minutes and protein containing supernatant was taken ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5×106 K562 cells were resuspended in PBS with EDTA-free protease inhibitor cocktail (Roche) and lysed using a 27.5G needle ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mM MgCl2 and 0.25 M sucrose) supplemented with a protease inhibitor cocktail tablet (Roche). Successively ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... fibronectin-coated (5 μg/cm2 coating the outer part of the membrane, Roche, cat#11080938001) inserts in 24-well plates (Corning-Falcon cat# 353097) ...
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA containing EEEb1 was labeled with cyanine-5-dUTP by Nick Translation Mix (Roche), while plasmid DNA harboring each of the other nine DNA families (EEEb2–EEEb10 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.2 μl (5 U/μl) FastStar Taq DNA Polymerase (Roche Diagnostics GmbH, Mannheim, Germany) in a total volume of 25 μl ...
-
Planarians employ diverse and dynamic stem cell microenvironments to support whole-body regenerationbioRxiv - Developmental Biology 2023Quote: ... Samples were blocked in MABT containing 5% horse serum and 1% Western Blocking Reagent (Roche). In situ signals were developed as previously reported ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.17 mg/mL 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; Roche, Basel, Switzerland) at room temperature for 1 h (Brn3acKOAP/cKOAP mice ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA diluted 1:5 in water was quantified using either SYBR Green I (Roche, # 04707516001) and a LightCycler 480 (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... rehydrated in PBST and bleached in formamide bleaching solution (4 hours) (5% formamide - Roche 11814320001), and 1.2% hydrogen peroxide (Sigma H1009) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Media was aspirated and minced tissue was digested with ∼5 mg of Collagenase P (Roche) in 5 mL cold HBSS for 15-20 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM TCEP and 5 % glycerol) supplemented with cOmplete EDTA-free protease inhibitor complex (Roche) and ribonuclease A (Roche) ...
-
bioRxiv - Physiology 2023Quote: ... Worms were homogenized in PBS containing 5% TritonX-100 and a protease inhibitor cocktail (Roche), and lipid was extracted using the TissueLyser II (QIAGEN ...
-
bioRxiv - Developmental Biology 2024Quote: ... NBT/BCIP (4-nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolylphosphate, Roche, 11681451001) was added after thoroughly washing samples ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Genomics 2021Quote: ... Final libraries were PCR-amplified during 5 cycles with Kapa HIFI PCR kit (Roche, Basel, Switzerland) before standard library quality control with standard sensitivity NGS Fragment kit (Agilent ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then treated with DNase-free RNase (Roche; 5 μg.ml-1; 37°C; 30 min) and proteinase K (250 μg.ml-1 ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Biophysics 2019Quote: ... (5) motor solution consisting of 2 μM biotinylated KIF1A in motor dilution buffer (1mM ATP [Roche] ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics). Color development was allowed to proceed overnight or was stopped after 2-3 hours (for quantification of npba expression in Vs/Vp ...
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Biochemistry 2020Quote: ... 5% (v/v) glycerol and 1 mM TCEP containing an EDTA-free protease inhibitor tablet (Roche). The cell suspension was sonicated on ice and clarified by centrifugation at 27,000g for 15 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.5mM Benzamidine) supplemented with 5 mM βME and 1x cOmpleteTM EDTA-free protease inhibitor cocktail (Roche). A similarly supplemented buffer A volume (2.5 PCV ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 μL of LightCycler® 480 SYBR Green I Master Mix (Hoffmann-La Roche, BSL, Switzerland), 1.5 μL of PCR-grade water and 2.5 μL of cDNA (concentration ranged from 50 pg/μL to 500 ng/μL) ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 mM Na3VO4] containing a protease inhibitor cocktail (Complete EDTA-free from Roche Diagnostics, Indianapolis, IN) and a phosphatase inhibitor cocktail (2×PhosSTOP from Roche Diagnostics) ...
-
bioRxiv - Cell Biology 2019Quote: ... the slides were incubated for 5 h at 8°C with mouse anti-DIG antibody (Roche, Basel ...
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Cancer Biology 2020Quote: ... Target cells with PBMCs in complete medium or supplemented with 5% Triton X-100 (Roche Diagnostics) were used to determine minimum and maximum release ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% [v/v] glycerol) supplemented with 1x cOmplete EDTA free protease inhibitor cocktail tablet (Roche #11873580001). Cells were lysed via sonication ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were blocked with 5% milk in TBS-T or 10% Western Blot Blocking Reagent (Roche) followed by primary antibody incubation overnight at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by multiplex immunofluorescence staining with a U DISCOVERY 5 plex immunofluorescence (Roche Diagnostics, Meylan, France). Three sequential rounds of staining were performed each including heat deactivation step ...
-
bioRxiv - Developmental Biology 2022Quote: ... rinsed 2 times for 5 minutes with alkaline phosphatase buffer and stained with NBT/BCIP (Roche) as described previously (Kraus et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 5 mM EDTA) in the presence of phosphatase and protease inhibitors (4906837001 and 4693159001, Roche). Cell lysate was subjected to immunoprecipitation with the related antibody and agarose beads ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 mM KCl) supplemented with protease and phosphatase inhibitor cocktails (Roche, cat#05892791001 and cat#04906837001), was used to homogenize brain tissue as described previously 55 ...