Labshake search
Citations for Roche :
451 - 500 of 3871 citations for 4F2 Cell Surface Antigen Light Chain SLC7A5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2019Quote: ... Polymerase Chain Reaction (PCR) amplification was conducted in 12.5 μl reaction volumes consisting of AmpliTaq® DNA polymerase (Roche Molecular Systems, Inc) forward and reverse primers (0.5 μM each) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative reverse transcription (qRT)-polymerase chain reaction (PCR) analysis of cDNA expressions was conducted using SYBR FAST Universal qPCR Master Mix (Kapa Biosystems; #KK4602) with a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... Abutting primer pairs were designed that were specific to these genetic groups (Supplementary Table 3) to enable the recovery of full viral genomes using polymerase chain reaction (PCR) with HiFi HotStart DNA polymerase (Kapa Biosystems, USA) using cycling conditions per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative reverse transcription polymerase chain reaction (qRT– PCR) was performed in optical 96-well plates via the LightCycler 480 II system (Roche Life Science) using KOD SYBR qPCR Mix (Toyobo) ...
-
bioRxiv - Cell Biology 2024Quote: ... Gene expression levels were quantified by Reverse Transcription quantitative polymerase chain reaction (RT–qPCR) using the LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland). Cycling parameters were set at (i ...
-
bioRxiv - Biophysics 2019Quote: ... The central fragment of the molecule is flanked by oligonucleotides labelled either with digoxigenin (3’ end) or biotin (5’ end) that specifically bind either to a glass surface covered with Anti-digoxigenin (Roche) or to superparamagnetic beads (MyOne ...
-
bioRxiv - Cell Biology 2020Quote: ... Japan) was employed for detection of proteins visualized by Lumi-light Plus Western blotting substrate (Roche, Basel, Switzerland).
-
bioRxiv - Cell Biology 2020Quote: ... DNA amounts were then determined by qPCR on a Light Cycler 480 using SYBRGreen qPCR master mix (Roche). Inputs were diluted 1:20 before qPCR ...
-
bioRxiv - Immunology 2021Quote: ... The SYBR Green Dye detection system was used for quantitative real-time PCR on Light Cycler 480 (Roche). Controls consisting of ddH2O were negative for target and housekeeping genes ...
-
bioRxiv - Developmental Biology 2021Quote: ... and ultra-purified water were mixed and pipetted into the plate and a Roche Light Cycler (Roche, city) was used to run a program consisting of 45 cycles ...
-
bioRxiv - Microbiology 2020Quote: Real time quantitative RT-PCR was performed with the Light Cycler RNA Master SYBR Green I kit (Roche), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... Products were amplified in a real-time PCR reaction with Light Cycler 480 Real-Time PCR System (Roche) using a UPL Probes Master mix (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... Japan) was employed for detection of proteins visualized by Lumi-light Plus Western blotting substrate (Roche, Basel, Switzerland).
-
bioRxiv - Immunology 2022Quote: ... qPCR was performed with SYBR Select Master Mix (thermo fisher) and analyzed on a Light Cycler 480 (Roche), enrichment calculated by ratio of DRIP/input ...
-
bioRxiv - Immunology 2022Quote: ... qPCR was performed using SYBR Select Master Mix (thermo fisher) and analyzed on a Light Cycler 480 (Roche). Gene of interest/ normalizing gene values ± SD were then normalized to the WT controls ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-PCR was carried out using SYBR Green master mix for detection in Light cycler LC 480 (Roche). All primers used for qRT-PCR are given in Supplementary Table S1.The endogenous control GAPDH was used to normalize quantification of the mRNA target.
-
bioRxiv - Developmental Biology 2022Quote: ... Expression of selected genes was quantified by Quantitative Real Time RT-PCR performed on a Light Cycler (Roche) or 7900HT fast real-time PCR system (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... for Quantitative RT-PCR (Supplemental Table 1) and amplified in a Roche Light Cycler 480 (Roche, Basel, Switzerland). Relative expression was quantified using Ct values ...
-
bioRxiv - Biochemistry 2021Quote: ... and monitoring fluorescence at 470:510 nm excitation: emission using the Light Cycler 480 II (Roche Applied Science). Samples were prepared in triplicate in 384 well plates (Axygen ...
-
bioRxiv - Genomics 2023Quote: ... and analyzed on a light cycler rapid thermal system (LightCycler®480 2.0 Real time PCR system, Roche). ChIP-qPCR results were normalized on input signal (% input) ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.5 μM RV primer and 1x Light Cycler SYBR Green LightCycler® 480 SYBR Green I Master (Roche). Amplification cycle was ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was analysed by real-time PCR with the Light Cycler 480 SYBR Green I Master Mix (Roche). A set of 3 household genes has been used to normalize (Cyclophilin ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative Real-time PCR was performed using a Light Cycler 480 Instrument II real-time PCR system (Roche). The relative expression levels of target genes were determined by the 2-ΔΔCt method using GAPDH as an internal control ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... The SYBR Green Dye detection system was used for quantitative real-time PCR on Light Cycler 480 (Roche). Gene-specific primers (Microsynth ...
-
bioRxiv - Plant Biology 2020Quote: ... and identified by morphological features.41 Polymerase chain reaction (PCR) products were purified with the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany), and sequenced in both directions by Macrogen Inc ...
-
bioRxiv - Genomics 2020Quote: ... Library concentrations were determined by quantitative polymerase chain reaction (qPCR) using the KAPA SYBR FAST ABI Prism qPCR Kit (Kapa Biosystems, Wilmington, MA) and the StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Pathology 2021Quote: ... A quantitative real time polymerase chain reaction (q-RT-PCR) was used to quantify the parasite load by using PCR SYBER Green Master Mix (Roche, Applied Science, CT) containing MgCl2 by employing QuantStudio 3 Real-Time PCR system (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The level of secreted prostate specific antigen (PSA) and T3 in the growth medium was determined using a validated Elecsys electrochemiluminescence immune assay (Roche, Rotkreuz, Switzerland) on a Cobas e601system (Roche ...
-
bioRxiv - Immunology 2023Quote: ... The formalin-fixed paraffin- embedded (FFPE) tissue sections underwent deparaffinization and heat-mediated antigen retrieval on the Ventana Discovery Ultra auto-stainer platform (Roche Diagnostics, Canada), following the below instructions ...
-
bioRxiv - Immunology 2019Quote: ... Amplification of cDNAs was performed by quantitative real-time PCR reactions on a Light Cycler instrument (LC480, Roche Diagnostics) with the Light Cycler 480 SYBR Green detection kit (Roche Diagnostics ...
-
bioRxiv - Genetics 2019Quote: ... Quantitative real-time PCR was performed with the LIght Cycler DNA Fast Start Master SYBR green I kit (Roche) in a Light Cycler 480 Instrument II at Tm=60°C ...
-
bioRxiv - Immunology 2020Quote: ... fluorogenic trials were performed using the reagent Light Cycler 480 SYBR Green I Master (Roche Applied Science, Mannheim, Germany). Fluorescence was detected in the equipment Light Cycler 480 Instrument (Roche Applied Science ...
-
bioRxiv - Molecular Biology 2021Quote: Telomere lengths from obtained DNA samples were determined in a quantitative real-time Light Cycler 480 PCR (Roche, Germany) device using appropriate primers (Tel F:CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGT and Tel R:GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT ...
-
bioRxiv - Molecular Biology 2021Quote: RT-qPCR were performed using the high-throughput Light Cycler 480 II Real-Time PCR system (Roche, Germany, Mannheim). In order to determine the genes expression levels of total RNA samples obtained from patient and control groups ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR was performed in optical 96-well plates using SYBR® green in a Light Cycler 480 (Roche). Primers were designed using Primer-Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR was performed in optical 96-well plates using SYBR® green in a Light Cycler 480 (Roche). Primers were designed using Primer-Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The experiments were carried out in 96-well reaction plates with a Light Cycler 96 Instrument (Roche, Basel, Switzerland). The reaction conditions were as follows ...
-
bioRxiv - Cell Biology 2022Quote: H3K4me3-immunoprecipitated genomic DNA was diluted 1:100 and Chip-qPCR performed with a Light Cycler 480II machine (Roche) using technical duplicates and ChIP-qPCR signals were calculated as % of input ...
-
bioRxiv - Microbiology 2023Quote: ... using 100 nL containing (final concentration) 1 × Light Cycler 480 SYBR® Green I Master Mix (Roche Inc., USA), nuclease free PCR-grade water ...
-
bioRxiv - Microbiology 2023Quote: ... Each 20 µl qPCR consisted of 10 µl 2× Light Cycle 480 SYBR Green I Master (Roche Applied Sciences), 1 µM each primer ...
-
bioRxiv - Immunology 2019Quote: ... after which bisulfite-converted libraries were amplified with 12 polymerase chain reaction (PCR) cycles using KAPA HiFi Hotstart Uracil+ ReadyMix and Ligation-Mediated PCR oligos (Roche Diagnostics Corp.,Indianapolis, IN). Samples submitted with less than one microgram of extracted gDNA were amplified with an additional 2 PCR cycles to increase concentration pre-capture ...
-
bioRxiv - Cancer Biology 2023Quote: ... The quantitative polymerase chain reaction was performed by using SYBR Green Master Mix on a LightCycler 480 PCR system (Roche Diagnostics, Indianapolis, IN, USA). Glyceraldehyde-3-phosphate dehydrogenase served as an internal control ...
-
bioRxiv - Biochemistry 2021Quote: ... The band corresponding to the crosslinked nanobody-antigen complex was then excised from the gel and subjected to in-gel digestion with trypsin (Roche, 1μg, 4 h) or chymotrypsin (Roche ...
-
bioRxiv - Developmental Biology 2019Quote: ... to visualise targeted cells we performed immunocytochemistry using anti-fluorescein antibodies (Roche 426346910).
-
bioRxiv - Developmental Biology 2022Quote: ... Cell death was revealed using the alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche) and NBT/BCIP (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 95°C for 5 min (90°C for 15 sec, 60°C for 60 sec) × 50 cycles (Light/Cycler Nano, Roche). The primer sets used in this study were described in the supplemental Table 1.
-
bioRxiv - Microbiology 2020Quote: ... All reactions were performed in 96-well plates on a Roche LC 480 or z480 light cycler (Roche, Basel, Switzerland) according to the CDC procedure including a previously negative patient specimen (extraction and RNaseP internal controls) ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR was performed with gene specific p rimers (see Key Resource Table) using Sybr green detection on a Light Cycler 480 (Roche) or Quantstudio6 (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse-transcription reactions were diluted 10-fold with water prior to qPCR which was performed in a Light Cycler 480 instrument (Roche) using the Brilliant III Ultra-Fast SYBR® Green qPCR Mastermix (Agilent) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 pmol of the forward and reverse gene-specific primers each in Light Cycler SYBR Green I Master mix (Roche) on LightCycler 480 II (Roche) ...