Labshake search
Citations for Roche :
101 - 150 of 2386 citations for 4 Amino 3 8 dichloro 5 methoxyquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 5-bromo4-chloro-3-indolyl phosphate toludinium (Roche Diagnostics, Cat. No 11383221001). Images were taken on a Zeiss Axio Compound Light Microscope with Optronics MacroFire Digital Camera.
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ and 3’ linkers were terminally labelled with digoxigenin-11-dUTP (Roche) or biotin-16-dUTP (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 mM MgCl2) containing 4-nitro blue tetrazolium chloride (NBT, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 8 min followed by post-coloration using Bluing reagent for 4 min at RT (Roche Diagnostic, Meylan, France). The slides were then dehydrated (ethanol and xylene ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Neuroscience 2024Quote: ... and BCIP (5-bromo-4-chloro-30-indoly phosphate p-toluidine salt, Roche). After development ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
Genomic organization of the autonomous regulatory domain of eyeless locus in Drosophila melanogasterbioRxiv - Genetics 2021Quote: ... The fixed embryos were resuspended in 2.5 ml of ice-cold lysis buffer (10 mM Tris-pH-8, 10 mM NaCl, 0.2% NP40 with Roche protease inhibitor cocktail freshly added ...
-
bioRxiv - Neuroscience 2020Quote: ... Each tissue sample was dissociated using 2.4 mL of homogenization buffer (10 nM Tris pH 8, 5 mM MgCl2, 25 mM KCl, 250 mM sucrose, 1 μM DTT, 0.5x protease inhibitor [cOmplete, Roche #4693159001] ...
-
bioRxiv - Biochemistry 2020Quote: ... re-suspended with buffer A (50mM Phosphate buffer pH 8, 400mM NaCl, 5% glycerol, 1mM DTT, 0.5mM EDTA, protease inhibitor cocktail from Roche) and lysed using a microfluidizer followed by two cycles of centrifugation (12000 × g 20 min) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were washed once with ice-cold 1X PBS and then swelling buffer (5 mM HEPES pH 8, 85 mM KCl, 0.5% IGEPAL-CA630, protease inhibitor cocktail (Roche)) was added to the cells ...
-
bioRxiv - Biochemistry 2022Quote: ... re-suspended with buffer A (50mM Phosphate buffer pH 8, 400mM NaCl, 5% glycerol, 1mM DTT, 0.5mM EDTA, protease inhibitor cocktail from Roche) and lysed using a microfluidizer followed by two cycles of centrifugation (12000 x g 20 min) ...
-
bioRxiv - Cell Biology 2021Quote: ... except that 5 mg of synchronized HeLa cell lysate in 8 M Urea with protease inhibitor cocktail (Roche, 4693116001) was diluted by PBS buffer to a final urea concentration of 1 M before incubating with the conjugated beads ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were lysed in 8 M urea buffer (8 M urea, 1 M Tris pH 7.4, 5 M NaCl) containing protease and phosphatase inhibitors (Roche) followed by sonication at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mM Tris pH 8, 3 mM MgCl2, 0.5% NP-40, 0.15 mM spermine, 0.5 mM spermidine, Roche EDTA-free protease inhibitor) and incubated on ice for 20 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... Then qPCR was performed in triplicate using 4 μl sample in 8-9 μl reaction with FastStart Universal SYBR Green Master Mix (Roche) and primers flanking each MseI cassette (Table S3).
-
bioRxiv - Cell Biology 2023Quote: ... The resulting supernatants were incubated for 16 h while rotating at 4°C with 8 µg/ml anti-GFP antibody (Roche). Protein A/G PLUS-Agarose (Santa Cruz ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Genetics 2021Quote: ... followed by addition of 5 µl of 4 µg/mL DNase-free RNase (Roche). Samples were loaded onto 96-well Qiacube-HT® columns and DNA was purified using a Blood & Tissue kit (Qiagen) ...
-
bioRxiv - Plant Biology 2023Quote: ... before to add chemiluminescent substrate CSPD® (disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2’-(5’-chloro)tricyclo [3.3.1.13,7]decan}-4-yl) phenyl phosphate) (Roche). The chemio-luminescent signal was detected by using a G-Box (Syngene).
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 100 mL of cold lysis buffer (50 mM HEPES pH 8, 175 mM NaCl, 5 % glycerol, 1 mM EDTA and 2 tablets of protease inhibitors by Roche). The bacterial solution was then incubated at room temperature (RT ...
-
bioRxiv - Biochemistry 2021Quote: Cells were washed 2x with PBS to remove excess biotin and lysed in highly stringent washing buffer 5 (WB5; 8 M urea, 1% SDS in 1X PBS) supplemented with 1x protease inhibitor cocktail (Roche) and 50 μM NEM ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were harvested by centrifugation at 7000g at 4°C for 10 minutes and resuspended in 25 mL of cold TBS buffer (50 mM Tris-HCl, 500 mM NaCl, pH 8) with 5% glycerol and EDTA-free protease inhibitors cocktail (Roche). Cells were lysed by sonication and purified using Glutathione-Sepharose 4B (Cytiva ...
-
bioRxiv - Microbiology 2021Quote: ... before being resuspended in 1 mL of lysis buffer (100 mM NaCl, 5% glycerol, 10 mM Tris, pH 8; one cOmplete Mini EDTA-free protease inhibitor pellet (Roche) per 15 mL) ...
-
bioRxiv - Cell Biology 2023Quote: ... 50 mM Tris pH 8, 450 mM NaCl, 1% CHAPS, 20 mM MgCl2, 5 mM ATP, 1 mM Dithiothreitol [DTT], 1X Roche Protease Inhibitor Cocktail ...
-
bioRxiv - Cell Biology 2023Quote: Cells were washed 2x with 1x PBS to remove excess biotin and lysed in highly stringent washing buffer 5 (WB5; 8 M urea, 1% SDS in 1x PBS) supplemented with 1x protease inhibitor cocktail (Roche) and 50 μM NEM ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked for 1 h in blocking reagent (100 mM Tris HCL pH 8; 150 mM NaCL; 5 g/L Blocking Reagent (#11096176001, Roche)) and treated for 1.5 h with primary antibody diluted in blocking reagent (NF-κB p65/RELA ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by an 8-minute perfusion with myocyte digestion buffer containing 5 mg of liberase dispase high DH enzyme (Roche) per digestion ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... rehydrated in PBST and bleached in formamide bleaching solution (4 hours) (5% formamide - Roche 11814320001), and 1.2% hydrogen peroxide (Sigma H1009) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 % NP40, 2.5 mM EDTA, 0.05 % NaDeoxycholate, 20 mM Tris-HCl pH 8, 1x of PhosSTOP, 1x Roche protease inhibitor mixture), and the TE buffer (same as for histones plus 1x PhosSTOP) ...
-
bioRxiv - Systems Biology 2023Quote: ... Then the pulverized samples were solubilized with 1000 μL extraction buffer (4% SDS, 100 mM Tris pH 8 supplemented with a cocktail of 1X protease inhibitors (Complete mini, Roche Diagnostics GmbH), 5 mM tris(2-carboxyethyl)phosphine (TCEP) ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from the mPFC tissues of CamK2A-Cre;Gpr158fl/fl mice and the controls (n = 4) at the age of 8 weeks with Tripure Isolation Reagent (Roche, Mannheim, Germany). RNA-sequencing (RNA-seq ...