Labshake search
Citations for Roche :
4851 - 4900 of 5370 citations for QuantiChrom Iron Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and a primer complementary to the template-switch adapter (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGCAGTGGTATCAACGCAG, adapter in italic) with the KAPA Real-Time Library Amplification Kit (Kapa Biosystems). Adapters were required for subsequent sequencing reactions ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems) prior to cluster generation.
-
bioRxiv - Neuroscience 2022Quote: ... Cerebellar specimen gained from 4-weeks old Prpf8Y2334N mice were processed using KAPA RNA Hyperprep Kit with RiboErase (Kapa Biosystems/Roche) due to discontinuation of the Lexogen library construction kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Cerebellar specimen gained from 4-weeks old Prpf8Y2334N mice were processed using KAPA RNA Hyperprep Kit with RiboErase (Kapa Biosystems/Roche) due to discontinuation of the Lexogen library construction kit ...
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were quantified by fluorometry on a Qubit instrument (LifeTechnologies, Carlsbad, CA) and by qPCR with a Kapa Library Quant kit (Kapa Biosystems-Roche) prior to sequencing ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We prepared the WGBS libraries according to MethylC protocol (Urich et al., 2015) and quantified them using a combination of KAPA Library Quantification kits (Kapa Biosystems) and an Agilent High Sensitivity DNA kit (Agilent Genomic) ...
-
bioRxiv - Physiology 2022Quote: ... 250 ng of total RNA was used to prepare barcoded RNA-seq libraries using Stranded RNA-Seq Kit with RiboErase (KAPA Biosystems). Samples were sequenced on the HiSeq 2500 (Figure 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library quality control was performed with an Agilent 2100 Bioanalyzer and quantity determined via the KAPA Library Quantification Kit (KAPA Biosystems).
-
bioRxiv - Bioengineering 2022Quote: The open-reading frame of the nikABCDE gene was amplified from genomic DNA belonging to Escherichia coli BL21(DE3) using the KAPA-HiFi Master Mix kit according to the manufacturer’s instructions (Kapa Biosystems, #KK2601). Primers are found in Supplementary Table 3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... We next amplified full-length 1.7kb NT5C2 DNA insert by PCR using KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems, #KK2601) and the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time PCR was carried out with the Light Cycler Fast Start DNA Master SYBR Green Kit (Roche Applied Science, Germany) using LightCycler (Roche Applied Science ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA from twenty-four females from each of the four groups was extracted using Roche High Pure™ PCR Template Preparation Kits (Roche Molecular Systems ...
-
bioRxiv - Cell Biology 2022Quote: ... Bulk RNA-seq libraries were prepared from 500 ng of total RNA for each sample using KAPA mRNA HyperPrep Kit for Illumina (Roche, #KR1352) following manufacturer’s instruction ...
-
bioRxiv - Genetics 2022Quote: ... a single ChIP and single input library was prepared from each of three plants using a KAPA HyperPrep kit (Roche #KK8502), amplified with 5 cycles of PCR ...
-
bioRxiv - Genomics 2022Quote: ... the fragments were treated with end-repair, A-tailing, and ligation of Illumina-compatible adapters (IDT, Inc) using the KAPA-Illumina library creation kit (KAPA biosystems). Plate-based DNA library preparation for Illumina sequencing was performed on the PerkinElmer Sciclone NGS robotic liquid handling system using Kapa Biosystems library preparation kit ...
-
bioRxiv - Immunology 2022Quote: ... Library quantification and quality checks were done using KAPA Library Quantification Kit for Illumina (#KK4824; Kapa Biosystems, Cape Town, South Africa), High Sensitivity D1000 DNA Kit on BioAnalyzer (#5067-4626/#5190-6502 ...
-
bioRxiv - Microbiology 2022Quote: ... The Kapa HyperPrep kit was used to prepare libraries from 50 μL of each sheared cDNA sample following modifications of the Kapa HyperPrep kit (version 8.20) and SeqCap EZ HyperCap Workflow (version 2.3) user guides (Roche Sequencing Solutions Inc.). Adapter ligation was performed for 1 hour at 20°C using the Kapa Unique-Dual Indexed Adapters diluted to 1.5 μM concentration (Roche Sequencing Solutions Inc.) ...
-
bioRxiv - Microbiology 2022Quote: ... Following DNA extraction Illumina shotgun sequence libraries were prepared using the Kapa HyperPrep kit according to manufacturer specifications (Roche; Basen, Switzerland). Libraries were sequenced on an Illumina NovaSeq S4 flow cell (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... genomic DNAs were fragmented using a Covaris S220 ultrasonicator and libraries were generated using KAPA LTP Library Preparation Kit (Roche, KK8230). To verify that the insertion was present in the genome at the correct location in both transfected lines ...
-
bioRxiv - Microbiology 2022Quote: ... hybridization and signal detection were carried out according to the instructions of the manufacturer (DIG RNA labelling kit and detection chemicals; Roche Diagnostics).
-
bioRxiv - Microbiology 2022Quote: ... automated extraction of total nucleic acids was performed on the MagNA Pure 96 system with the DNA and Viral NA Small Volume 2.0 kit (Roche, Meylan, France). HBV-DNA was quantified in IU/mL (WHO Standard ...
-
bioRxiv - Plant Biology 2022Quote: ... The libraries were constructed at the Genomics Core Facility at West Virginia University using the KAPA mRNA Stranded Kit (KAPA Biosystems), and then 150-bp paired-end sequenced at the BioHPC Lab at Cornell University using an Illumina NextSeq 500 platform ...
-
bioRxiv - Plant Biology 2022Quote: ... The products then transferred from the gel to Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics) according to manufacturer’s protocol.
-
bioRxiv - Systems Biology 2022Quote: ... Libraries were prepared by the Genome Technologies core facility at The Jackson Laboratory using the KAPA mRNA HyperPrep Kit (KAPA Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The products were then transferred from the gel to the Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics), according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... Library construction of 300 ng total RNA for each sample was made using KAPA Stranded mRNA-Seq Kit (Illumina) (Kapa Biosystems), using 10 cycles of PCR amplification ...
-
bioRxiv - Genomics 2022Quote: ... sciMET(mg) and sciEM(combined n9 & mg) were performed using the KAPA qPCR Illumina library quantification kit (Kapa Biosystems Cat. KR0405) and the mean of each sciMET result (n9 = 397nM ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative real-time polymerase chain reaction (qRT-PCR) was performed with the KAPA SYBR Fast qPCR kit (KAPA Biosystems Cat# KK4608) on a CFX96 Real-Time PCR Detection System (Bio-Rad RRID ...
-
bioRxiv - Immunology 2022Quote: Viral RNA was extracted using the MagNA Pure 96 DNA and Viral Nucleic Acid kit on the MagNA Pure 96 system (Roche Diagnostics) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The fragments were treated with end-repair, A-tailing, and ligation of Illumina compatible adapters (IDT, Inc) using the KAPA-HyperPrep kit (KAPA Biosystems). The prepared libraries were quantified using KAPA Biosystems’ next-generation sequencing library qPCR kit and run on a Roche LightCycler 480 real-time PCR instrument ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library quality control was performed with an Agilent 2100 Bioanalyzer and quantity determined via the KAPA Library Quantification Kit (KAPA Biosystems). WGBS libraries were then pooled to meet the required 1µg DNA input necessary for targeted enrichment ...
-
bioRxiv - Systems Biology 2024Quote: ... Shotgun metagenomic sequencing libraries were prepared using a miniaturized version of the Kapa HyperPlus Illumina-compatible library prep kit (Kapa Biosystems). DNA extracts were normalized to 5 ng total input per sample using an Echo 550 acoustic liquid handling robot (Labcyte Inc) ...
-
Dysregulated expanded endocannabinoid system as therapeutic targets of amyotrophic lateral sclerosisbioRxiv - Neuroscience 2024Quote: ... The libraries were quantified using KAPA Library Quantification kits for Illumina Sequencing platforms according to the qPCR Quantification Protocol Guide (KAPA BIOSYSTEMS) and qualified using the TapeStation D1000 ScreenTape (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The V4–V5 regions of 16S rRNA gene were amplified using specific primers and libraries were constructed using the Hyper Library Preparation Kit from Kapa Biosystems (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA sequencing (RNA-seq) libraries were prepared from 4 µg of total RNA using the KAPA stranded mRNA-seq kit (Roche, KK8421) according to manufacturer’s specifications ...
-
bioRxiv - Plant Biology 2024Quote: ... Digoxigenin-labeled sense and antisense RNA probes based on the sequence of TaABI3-A1 were synthesized using a DIG northern Starter Kit (Roche, 11277073910), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and quantified using the qPCR-based quantification in order to ensure only NGS-compatible amplicon was quantified using the Library Quant ROX Low Kit (Kapa Biosystems) on a QuantStudio™ 6 Realtime PCR System (ThermoFisher) ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were washed three times with TBS-T and were incubated with a TUNEL reaction mixture (In Situ Cell Death Detection Kit, TMR red, Roche 12156792910) for 1 h at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Library QC was done using Qubit and BioAnalyzer and the final libraries were quantified using KAPA Library Quantification Kit (Roche, 07960140001). Libraries were diluted to 2 nM final concentration for pooling ...
-
bioRxiv - Developmental Biology 2024Quote: ... the tail of each embryo was collected for genomic DNA extraction using the KAPA Mouse Genotyping Kit HotStart (Kapa Biosystems, KK7352). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... and a sgRNA preceded by a rrk1 leader and followed by a Hammerhead Ribozyme as described in [17] was digested and prepared for gap repair as follows: the vector pJB166 was purified from DH5α bacterial cells using the Genopure plasmid midi kit (Roche, 03143414001) and diluted to 1 μg/μL ...
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative real time PCRs (qPCRs) were performed in a total volume of 10 µl with Kapa SYBR Fast qPCR kit (KAPA Biosystems) on an ABI 7500 fast machine operated with ABI 7500 software (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Per sample 200 ng of total RNA was used for library preparations with the KAPA RNA HyperPrep Kit with RiboErase (HMR) (Kapa Biosystems), including steps of the oligonucleotide hybridization ...
-
bioRxiv - Developmental Biology 2024Quote: Pitx1 WISH was performed on E12.5 embryos with a digoxigenin-labelled Pitx1 antisense probe designed from a cloned antisense probe (PCR DIG Probe Synthesis Kit, Roche 11636090910). Experimental procedure followed the protocol outlined in (Kragesteen et al. ...
-
bioRxiv - Genomics 2024Quote: ... We used 10 ng of DNA from two biological replicates to generate sequencing libraries using KAPA Hyper Prep Kit (KAPA Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... but replaced the Zymo-Spin V column binding apparatus with a high pure extender assembly from the High Pure Viral Nucleic Acid Large Volume Kit (Roche 05114403001). Double-stranded Illumina libraries were prepared using the Blunt-End Single Tube (BEST ...
-
bioRxiv - Genomics 2024Quote: ... mRNA was then isolated and RNA-Seq library was prepared following the KAPA RNA HyperPrep Kit protocol (Roche, Cat. No: 08098123702). The RNA- seq libraies were sequenced by NovaSeq 6000 (Illumina ...