Labshake search
Citations for Roche :
4501 - 4550 of 10000+ citations for Cyclic GMP cGMP ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: ... pH 7.4) with 1 mg/ml collagenase B (Roche). We harvested the kidneys ...
-
bioRxiv - Systems Biology 2022Quote: ... and 1 % IGEPAL/NP-40 supplemented with PhosSTOP (Roche) and cOmplete ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% NP-40 with protease and phosphatase inhibitors (Roche). DRG were further lysate by sonicated (Vibra-Cell™ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1% Triton X-100 and protease inhibitor tablets (Roche)) supplemented with 0.5% SDS and 0.2% n-lauroylsarcosine and sonicated using a Bioruptor (Diagenode ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-DIG AP antibody (Roche, Bâle, Switzerland, 1:4000) was added in fresh blocking solution and incubated at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM Na3VO4) supplemented with complete protease inhibitors (Roche) and the collected supernatant was used for western blotting ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-HA (rat monoclonal 3F10, Roche #11867431001, 1:5000), anti-TFR (monoclonal H68.4 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM DTT and 1 × cOmplete protease inhibitors (Roche) and sonicated for 15 minutes total time (10s on/20s off ...
-
bioRxiv - Cancer Biology 2022Quote: ... and digested with 1 mg/ml collagenase D (Roche) and 100 µg/ml DNase I (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... with antigen retrieval using Cell Conditioning 1 (CC1, Roche) for 48 minutes and primary antibody incubation for 60 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Proteinase K (Roche; 1 h at 55 °C) and DNA recovered using PCR purification kit (Qiagen).
-
bioRxiv - Immunology 2024Quote: ... cOmplete protease inhibitor (1 tablet / 10 ml) (Roche, 11697498001). Protein lysates were resolved on a NuPAGE™ 4 to 12% ...
-
bioRxiv - Microbiology 2024Quote: ... 1 tablet Complete Ultra Protease Inhibitor Cocktail/PhosSTOP (Roche), ultrapure water) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM EDTA and complete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... with the following modifications: 1 x PhosSTOP (Roche, 4906845001) was included in all solutions up to and including the primary antibody incubation ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 EDTA-free mini cOmplete EASYpack tablet (Roche 04693159001), and 1 mini PhoSTOP EASYpack tablet (Roche 04906845001) ...
-
bioRxiv - Immunology 2023Quote: ... enzymatic dissociation with 1 μg/ml Collagenase D (Roche) and 25 μg/mL DNAse I (ThermoFisher ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 μl of 10 mM probe (Roche Universal ProbeLibrary), and 36 μl of 2.2X Master mix was dispensed into wells containing 4 μl aliquots of the dilution series or a 4 μl aliquot of distilled water for a negative template control ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 mM EDTA and 0.1% protease inhibitor cocktail (Roche)] and three times with 1 X PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... rehydration and permeabilization steps (1:3000 Proteinase K (Roche) in PBS-DEPC ...
-
bioRxiv - Neuroscience 2024Quote: ... protease inhibitor tablets (1 tbl/10 ml, #4693159001, Roche), AEBSF (1:100 ...
-
bioRxiv - Neuroscience 2024Quote: ... rat anti-HA (1:500; Roche, cat no:423001).
-
bioRxiv - Neuroscience 2023Quote: ... sheep anti-Digoxigenin-POD (Roche Applied Science; 1:2,000), and sheep anti-Fluorescein-POD (Roche Applied Science ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25 or 0.17 mg ml−1 Liberase (Roche Diagnostics). The digested lungs were passed through a 1 ml syringe to make single-cell suspensions ...
-
bioRxiv - Physiology 2023Quote: ... a protease inhibitor (1 minitab per 10 mL, Roche), pH = 7 ...
-
bioRxiv - Genomics 2023Quote: ... 1% sodium deoxycholate) containing 1x protease inhibitor cocktail (Roche) for 30min on ice ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM PMSF and Complete protease inhibitor cocktail (Roche) at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM PMSF and Complete protease inhibitor cocktail (Roche)] ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 tablet of Complete Mini EDTA-free (11836153001, Roche). The embryos in CDS were flash frozen in liquid nitrogen and samples were stored at -80 °C until they were genotyped and could be combined according to their genotype for further usage ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:50 protease inhibitor (Complete Tablets EASYpack; 04693116001; Roche), 1:100 Phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Immunology 2023Quote: ... and incubated with 1 mg/ml collagenase D (Roche) and 0.1 mg/ml DNase I (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 mM phenylmethylsulfonyl fluoride (PMSF) (Roche, Cat # 10837091001). The lysate was passed 10 times through a 25-gauge needle ...
-
bioRxiv - Cell Biology 2024Quote: ... or 1/5th volume of anti-GFP antibody (Roche) and 50μl of 0.1M Na-phosphate with gentle agitation for 30min at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with collagenase D (1 mg/ml; Roche) in RPMI1640 medium at 37 °C for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... this contained 1× KAPA HiFi master mix (Roche, #KK2601), 0.5 μM Smart-seq3 forward primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG ...
-
bioRxiv - Biochemistry 2023Quote: ... Following antibody incubation (anti-GFP, 1:1000, Roche #118144600001), membranes were developed in ECL and imaged using the Chemidoc imaging system (Bio-Rad) ...
-
bioRxiv - Biochemistry 2023Quote: ... in 1× HiFi reaction buffer with MgCl2 (05917131103, Roche) were mixed with either 5’ sg RNA or 3’ sgRNA forward primer targeting the OvoA gene ...
-
bioRxiv - Biochemistry 2024Quote: ... 1% Triton X-100) supplemented with protease inhibitors (Roche). Immunoprecipitation ...
-
bioRxiv - Biochemistry 2024Quote: ... EDTA-free protease inhibitor pellet (1 capsule/ 50ml, Roche)) and lysed by a cell disruptor ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-GFP (Roche, 11814460001; 1:10,000 for WB), mouse anti-α-tubulin (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 mM type 1 collagen (Roche Diagnostics) to allow spheroid formation and seeded onto the ULA plates at a concentration of 5 × 103 cells per well ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1% NP-40) containing 1x complete Mini (Roche) and 1x PhosSTOP (Roche) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 × phosphatase inhibitor (PhosSTOP, 04906837001, Roche, Basel, Switzerland).
-
bioRxiv - Microbiology 2023Quote: ... 1% DDM and EDTA-free protease inhibitor cocktails (ROCHE)) and incubated for 30min at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... and 1:8000 secondary anti-DIG-PO antibodies (Roche) were added ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-DIG-POD (Roche Cat. N: 11207733910, 1:500) and Anti-FITC-POD (Roche Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 mM NaF and protease inhibitor cocktail (Roche, 04693132001). After centrifuge at 4 ℃ ...
-
bioRxiv - Immunology 2023Quote: ... while stimulation with phytohemagglutinin (PHA, Roche, 1 μg/ml) was included as the positive control ...
-
bioRxiv - Microbiology 2023Quote: ... before application of Anti-His6-Peroxidase (Roche, 1:1000) in 5% (v/w ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 tablet of EDTA-free protease inhibitor tablet (Roche), and 1 mM phenylmethylsulfonyl fluoride (PMSF) ...