Labshake search
Citations for Roche :
401 - 450 of 1334 citations for n4 Benzoyl 5 methyldeoxycytidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... all membranes were blocked with 5% Western Blocking Reagent (Roche, Indianapolis, IN, USA) in TBST ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the following were mixed: 5 μL Kapa HiFi buffer 5X (Kapa Biosystems, USA), 0.75 μL dNTPs 10 μM ...
-
bioRxiv - Immunology 2021Quote: ... and 5 mM Na3VO4) in the presence of complete Protease Inhibitor Cocktail (Roche). The cell lysates were incubated on ice for 30 min and were then centrifuged for 20 min at 15,000 rpm at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercapto-ethanol) supplemented with 5 μg/ml DNase I (Roche) and lysed using a homogenizer (Avestin Emulsiflex C5 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 10 mM imidazole supplemented with EDTA-free protease inhibitor (Roche). The cell suspension was lysed by ultrasonication and the lysate was cleared by centrifugation at 40,000 x g for 40 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Mannheim, Germany Cat#11383221001) was used in conjunction with nitro blue tetrazolium (NBT ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... Cytokines were added at the following concentrations: GM-CSF (5 ng/mL, Roche), TNF (10 ng/mL ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5) Incubated with 50μL of TUNEL reaction mixture for one hour (Roche protocol); 6 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5% glycerol) containing a protease inhibitor cocktail (Roche,11 697 498 001). The cell lysates were further sonicated on ice for 10 seconds ...
-
bioRxiv - Genetics 2023Quote: ... 5 mM Tris-HCl (pH 7.4) supplemented with Protease Inhibitor cocktail (Roche, #04693159001) and transferred to a 7 mL Dounce tissue grinder (KIMBLE KONTES ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... determined as the amount of 5-bromo-2′-deoxy-uridine (BrdU) incorporation (Roche BrDU Labeling and Detection Kit II ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 7.6 with KOH) containing 5 mg ml−1 collagenase (type A, ROCHE). Defolliculated oocytes were injected with 50 ng mRNAs of mixed GlyT1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and BCIP (5-bromo-4-chloro-30-indoly phosphate p-toluidine salt, Roche). After development ...
-
bioRxiv - Immunology 2024Quote: ... Cell nuclei were stained with 5 µg/ml of DAPI (10236276001, Roche Diagnostics).
-
bioRxiv - Immunology 2023Quote: ... 5 mM EDTA] supplemented with 1x protease inhibitors (Mini Protease Inhibitor Tablets, Roche). Total protein concentration was determined by BSA Protein Assay Kit (Thermo Life) ...
-
bioRxiv - Genetics 2023Quote: ... Each reaction consisted of 5 μL LightCycler 480 SYBR Green Master mix (Roche), 0.5 μL each of the forward and reverse primers (100 μM ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The cell proliferation ELISA BrdU (5′-bromo-2′-deoxyuridine) colorimetric assay (Roche,11647229001) was performed as per the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... then 5 min at 62°C) with KAPA HiFi HotStart Ready Mix (Roche). Libraries were quantified by Bioanalyzer (Agilent ...
-
bioRxiv - Biochemistry 2023Quote: ... 5% glycerol) containing a protease inhibitor cocktail tablet (Complete EDTA-free, Roche Diagnostics) and gently stirred for 30 min in the presence of 0.2 mg/mL lysozyme (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... 5% glycerol) supplemented with Complete Mini protease inhibitor mixture tablet (Roche Applied Science) and 10 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Microbiology 2022Quote: ... and blocked at room temperature with either 5% bovine serum albumin (BSA, Roche), 5% milk or Odyssey buffer (1:1 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% glycerol) containing 1× complete EDTA-free protease inhibitor cocktail (Roche 1187358001) and lysed in an Emulsiflex-C5 cell disruptor (Avestin) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Developmental Biology 2023Quote: ... using a 5 μl reaction mixture of DNA SYBR Green I Master (Roche) according to the standard manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche). The reaction was stopped with PBS and the sections were mounted in Glycergel (Dako) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM beta-mercaptoethanol (BME)) with cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). After lysate centrifugation at 48.384g for 45 min at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5% (v/v) glycerol) supplemented with protease inhibitor cocktail tablets (cOmpleteTM, Roche). The suspensions were kept on ice ...
-
bioRxiv - Biochemistry 2024Quote: ... The cleared lysate was loaded onto a Ni2+- NTA column (5 ml, Roche) prewashed with lysis buffer ...
-
bioRxiv - Immunology 2024Quote: ... 5’-GGAGACGATCTTACGCACTGA-3’) were designed using the Universal ProbeLibrary software (Roche Life Sciences). Results were normalized to the expression level of the endogenous references genes (TBP ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM beta-mercaptoethanol (BME)) with cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). After lysate centrifugation at 48,000g for 45 min at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... media was replicated by a 5% solution of WST-1 reagent (Roche, 11644807001) in media ...
-
bioRxiv - Developmental Biology 2024Quote: ... uridine-5’-triphosphate (UTP) and T7 /SP6 RNA polymerase (Roche, Cat. 10881775001/10810274001).
-
bioRxiv - Cancer Biology 2021Quote: ... proliferation was measured using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells were pulsed with 10μM BrdU ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and protease inhibitor cocktail (Roche cat. no. 04693124001) and phosphatase inhibitor (Roche cat ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Neuroscience 2021Quote: Zebra finches received intramuscular (I.M.) injections of 2-Bromo-5’-deoxyuridine (BrdU; Roche Diagnostics) in 0.05 M tris buffered saline (TBS ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% glycerol with protease inhibitors (Roche, 1 tablet per 10 mL lysis buffer). Worm slurry was frozen in liquid nitrogen and stored at -80 °C until lysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... in an IP buffer (1xPBS, 5% glycerol, 0.5 mM EDTA, 1mM PMSF, 1x Roche cOmplete™Protease Inhibitor Cocktail ...
-
bioRxiv - Genetics 2021Quote: ... followed by addition of 5 µl of 4 µg/mL DNase-free RNase (Roche). Samples were loaded onto 96-well Qiacube-HT® columns and DNA was purified using a Blood & Tissue kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The supernatant was incubated at 55 °C overnight with 5 µL proteinase K (Roche). Genomic DNA was extracted with phenol:chloroform extraction.
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and supplemented with 5 mM CaCl2 and 15 units of S7 micrococcal nuclease (Roche). Lysates were sonicated for 10 seconds at low power followed by incubation on ice for 30 minutes and clarification by centrifugation at 13,000 x g for 15 minutes at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 hours incubation in MTSB containing 2 % BSA containing either an anti-GFP (Roche) or an anti-PIN1 monoclonal antibody at 0.1 % ...
-
bioRxiv - Plant Biology 2021Quote: ... in a total volume of 5 µL and analyzed on a Lightcycler 480 (Roche). Each reaction was done in three technical and three biological repeats ...
-
bioRxiv - Microbiology 2021Quote: ... Western-blot antibody detection was used using antibodies from Roche Diagnostics Mannheim Germany (Anti-HA, mouse monoclonal primary antibody (12CA5 Roche, 5 mg/ml) at a dilution of 1:1000 ...
-
bioRxiv - Physiology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Cell Biology 2021Quote: Using serum-free media supplemented with 5 g/l BSA fraction V (Roche, #107351080001), islets were pre-treated with 100 nM CCK ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 mM β-mercaptoethanol and the EDTA-free complete ULTRA protease inhibitor cocktail (Roche). Proteins were batch-purified using Ni-NTA agarose resin (Macherey-Nagel ...