Labshake search
Citations for Roche :
401 - 450 of 759 citations for Sar1 Angiotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... The DSF assay was conducted on a LightCycler 480 II Real-Time PCR (Roche) with the excitation and emission wavelengths set to 465 and 580 nm ...
-
bioRxiv - Genetics 2019Quote: ... Amplification products were detected on the LightCycler 480 II Real-Time PCR instrument (Roche). LightCycler 480 Software was used to quantify products by absolute quantification analysis using the second derivative maximum method ...
-
bioRxiv - Cell Biology 2021Quote: ... ATP quantitation was performed with the ATP Bioluminescence Assay Kit CLS II (Roche Diagnostics) using a Glomax 96 Microplate Luminometer as described (Chaya et al ...
-
bioRxiv - Biochemistry 2021Quote: Relative cell viability was assessed using the XTT cell proliferation Kit II (Roche Diagnostics) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... The analysis was carried out on a LightCycler 480 II (SW1.5.1 Version; Roche Diagnostics) with the SYBR Green I Master kit (Roche Diagnostics ...
-
bioRxiv - Microbiology 2020Quote: XTT assays were performed using Cell Proliferation Kit II (XTT) (Roche Diagnostics, Mannheim, Germany) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PCR reactions were performed on a LightCycler 480 Instrument II (Roche). Delta-delta-cycle threshold (ΔΔCT ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Genetics 2022Quote: ... Real-time PCR quantification (qPCR) was performed on LightCycler 480 II (Roche, Basel, Switzerland) using the QuantiTect SYBR Green PCR Master Mix (Qiagen) ...
-
bioRxiv - Immunology 2022Quote: ... Quantification of relative mRNA levels was performed with the LightCycler 480 Instrument II (Roche) using Taq-Man PCR technology ...
-
bioRxiv - Plant Biology 2022Quote: ... to perform RT-qPCR in a LightCycler 480 II instrument (Roche Applied Science, UK). The cycle conditions were ...
-
bioRxiv - Immunology 2022Quote: ... Mouse tail epidermis was separated from dermis by 5 mg/ml Dispase II (Roche) digestion in 37°C for 1 hr ...
-
bioRxiv - Cancer Biology 2022Quote: ... the tumors were chopped finely and digested with 30mg/mL dipase II (Roche 28405100), 10mg/mL collagenase I (Worthington LS004194 ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative RT-PCR (qRT-PCR) was performed using an LightCycler® 480 II (Roche) and SYBR Green PCR Master Mix (Vazyme ...
-
bioRxiv - Bioengineering 2021Quote: ... either using 20 μL reaction volume in a LightCycler® 480 System II (Roche), or using 5 μL reaction volume in a C1000 Touch thermal cycler (Bio-Rad) ...
-
bioRxiv - Neuroscience 2022Quote: ... Each qPCR reaction was run in duplicates on a LightCycler ® 480 II (Roche). The thermo cycling profile included an initial denaturation of 3 minutes at 95°C ...
-
bioRxiv - Microbiology 2019Quote: ... qRT-PCR reactions were performed in a Light Cycler 480 II (Roche, Basel, Switzerland) using 1 μg of cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... qRT–PCR was performed using a LightCycler 480 II instrument (Roche Molecular Systems, Inc.) and TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Microbiology 2020Quote: ... The ATP content was determined using the ATP Bioluminescence Assay Kit CLS II (Roche). Subsequently ...
-
bioRxiv - Immunology 2020Quote: ... skin biopsies were incubated in 5mL of a 0.4% Dispase II solution (Roche Inc.) at 37°C for 1 hour with vigorous shaking ...
-
bioRxiv - Biochemistry 2022Quote: ... Three technical replicates were prepared three times and measured on LightCycler 480 II (Roche). High-resolution melting curves were obtained by measuring the complex stability by temperature increase to 80 °C and then decrease to 20 °C with a ramp rate 0.01 °C/s in three cycles and thus obtaining a total of 27 melting curves per sample ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR reactions were performed on a LightCycler 480 II Real Time PCR Instrument (Roche) and analyzed using LightCycler 480 Software ...
-
bioRxiv - Developmental Biology 2022Quote: ... then 1 ml of a digestion medium containing 10 U ml dispase II (Roche) and 125 U ml of collagenase type IV (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Excised skin was placed in a 0.5% Dispase II solution (diluted in PBS; Roche) and placed at 4ºC overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative PCR (qPCR) was performed using LightCycler® 480 II system (Roche Diagnostics, Switzerland) with the following conditions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the resulting cDNA was examined by real-time PCR (LightCycler 480 II, Roche). The cycle threshold (Ct ...
-
bioRxiv - Bioengineering 2023Quote: ... qPCR was performed in 384-well plates using the LightCycler 480 Instrument II (Roche). Target gene expression change was calculated relative to non-targeting controls using the ddCt method.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 20 µg mL-1 luciferase reagent (ATP Bioluminescence Assay Kit CLS-II, Roche). The reaction was initiated with 200 µM NADH ...
-
bioRxiv - Microbiology 2023Quote: ... samples were cut into ≤5mm diameter pieces and incubated with dispase II (4942078001, Roche) for 2 h at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: DSF measurements were taken using a Light Cycler 480 II instrument (Roche Applied Sciences). Protein samples were prepared in 20 µl containing 0.1 mg ml−1 SKP1/FBXO22 ...
-
bioRxiv - Pathology 2023Quote: ... The amplification of cDNA were performed by LightCycler 480 II (Roche Life Science, USA) with the following protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... E2 levels were assessed using an E170 Modular (Gen II, Roche Diagnostics, Mannheim, Germany). To convert these E2 values ...
-
bioRxiv - Genetics 2024Quote: ... and digested with NB4 collagenase (12mg/ml) (SERVA) and Dispase II (100U/ml) (Roche) for 1 hour ...
-
bioRxiv - Biochemistry 2024Quote: ... DSF was performed in a Light Cycler 480 II (Roche Applied Science, Penzberg, Germany) using a 4 °C/min temperature gradient from 20 °C to 95 °C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The real time PCR program of the quantitative PCR (LightCycler480 II, Roche, Basel, Switzerland) was arranged as follows ...
-
bioRxiv - Physiology 2024Quote: ... HRM analysis was performed on the LightCycler 480 System II (Roche Diagnostics, Basel, Switzerland) using the LCGreen Plus dye (BioFire Defense ...
-
Modular structure of RNA 3’ processing condensates involving the Arabidopsis RNA binding protein FCAbioRxiv - Molecular Biology 2024Quote: ... All the samples including inputs were subjected to qPCR analysis via LightCycler480 II (Roche). The data were normalized to 1% of input ...
-
bioRxiv - Molecular Biology 2024Quote: ... Real-time PCR was conducted on a Light Cycler 480 II (Roche, Mannheim, Germany) using ChamQ SYBR qPCR Mix (Q711 ...
-
bioRxiv - Neuroscience 2024Quote: ... as per the manufacturer’s protocol on the LightCycler® II 480 system machine (Roche). Primer sequences are detailed in Table S2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative real-time PCR was performed on the LightCycler 480 Instument II (Roche Life Science) using LightCycler480 SYBR GREEN I master (Roche Life Science) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligo dT(18)-primed reverse transcription was carried out with ImProm-II Reverse Transcriptase (Roche). Semi-quantitative radioactive PCR (RT-PCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligo dT(18)-primed reverse transcription was carried out with ImProm-II Reverse Transcriptase (Roche). Semi-quantitative radioactive PCR (RT-PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... the sections were equilibrated with buffer II [Buffer I containing 0.5% Blocking reagent (Roche, Germany)] at room temperature for 1 h before incubation with alkaline phosphatase-conjugated anti-digoxigenin antibody (1:500 dilution) ...
-
bioRxiv - Bioengineering 2019Quote: Quantitative real-time expression analysis was performed using a LightCycler®480 II instrument (Roche) equipped with 384 well plates and PowerUp™ SYBR™ Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2019Quote: ... using a luciferase based bioluminescence assay (ATP Bioluminescence Assay Kit HS II, Roche Applied Science). 3 thoraces were used for one assay and 3∼4 assays were performed for each genotype.
-
bioRxiv - Microbiology 2019Quote: ... The qPCR reactions were performed on a LightCycler® 480 II instrument (Roche Diagnostics, Switzerland) in two technical replicates on the reverse-transcribed RNA isolated from four biological replicates ...
-
bioRxiv - Microbiology 2019Quote: ... The qPCR reactions were performed on a LightCycler® 480 II instrument (Roche Diagnostics, Switzerland) in two technical replicates on 50 ng template DNA extracted with a YeaStar Genomic DNA kit (Zymo Research ...
-
bioRxiv - Genomics 2020Quote: ... on a Roche LightCylcer 480 Instrument II using LightCycler 480 SYBR GreenI Master (Roche, NJ). Primers were designed using Primer Blast ...
-
bioRxiv - Microbiology 2020Quote: ... All qPCR experiments were performed in a LightCycler® 480 Instrument II (Roche Molecular Diagnosis), with the following conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... and primers listed in Supplementary Table 1 on LightCycler® 480 PCR instrument II (Roche). Primer efficiencies were determined by serial dilutions of input samples and were used for analysing the results ...