Labshake search
Citations for Roche :
401 - 450 of 9037 citations for Mouse DTW Domain Containing Protein 2 DTWD2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2020Quote: ... Total and small RNA (containing microRNA) were extracted from MΦ using the Roche High Pure miRNA Isolation kit (Roche, Milan) or the Quick-RNA MicroPrep from Zymo Research (Irvine ...
-
bioRxiv - Neuroscience 2021Quote: ... the circular DNA fragment containing the shotV104 breakpoint region was amplified using a High Fidelity PCR Kit (Eppendorf and Roche). PCR products were gel-extracted ...
-
bioRxiv - Plant Biology 2022Quote: ... and 72°C for 20 s) containing the Spartina cDNAs with the PCR DIG Probe Synthesis Kit (Roche, Cat.11636090910) using the SaHKT1 transcripts specific primers (Forward primer ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 µg of RNA was reverse-transcribed with Transcriptor First Strand cDNA synthesis Kit (Roche, www.roche.com). The A ...
-
bioRxiv - Pathology 2023Quote: ... 2 canine gastrointestinal biopsies and 5 canine normal tissues (High Pure PCR Template Preparation Kit, Roche Applied Science ...
-
bioRxiv - Neuroscience 2021Quote: ... NeuroMab; HCN2: mouse, 75-111, NeuroMab; HCN3: mouse, 75-175, NeuroMab; HCN4: mouse, 75-150, NeuroMab; HA: mouse, 12CA5, Roche) in 1% milk powder and incubated overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: Anti-SARS-CoV-2 (N protein) IgM/IgG levels in the serum were measured using an Elecsys Anti-SARS-CoV-2 with cobas8000 (Roche Diagnostics KK) at the Department of Clinical Laboratory ...
-
bioRxiv - Neuroscience 2020Quote: DNA was extracted from mouse ear biopsies using High Pure PCR Template Preparation Kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: DNA was extracted from tail or ear clippings using the Kapa Mouse Genotyping Standard kit (KAPA Biosystems) and stored at -20°C ...
-
bioRxiv - Molecular Biology 2024Quote: Genomic DNA (gDNA) was isolated from mouse ear punch biopsies using the PCR Template Preparation kit (Roche). Targets was PCR amplified using Taq Polymerase (Roche ...
-
bioRxiv - Immunology 2021Quote: ... Mouse (Roche) on the LightCycler 2.0 (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Dynabeads™ were washed once with 2 ml of PBS and coated with 15 μg of mouse monoclonal anti-GFP antibody (Roche Applied Science). The beads were finally washed three times with 2 ml of lysis buffer and added to the whole cell extract for a 2 h incubation with gentle rotation ...
-
bioRxiv - Physiology 2019Quote: ... in the lysis buffer (buffer ATL and protinase K) provided in the above DNA isolation kits using a Roche Magnalyser instrument and homogenization tubes containing ceramic beads (Roche, UK). UBR5 PCR primers and pyrosequencing primers were purchased from EpigenDX (Hopkinton ...
-
bioRxiv - Molecular Biology 2020Quote: ... A-tailed and ligated to an adaptor in the form of a uracil-containing stem-loop using the KAPA HTP Library Preparation Kit PCR Free (KAPA Biosystems). Lambda exonuclease (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... All PCR reactions were performed using SYBR-containing master mix from the KAPA Real-Time Library Amplification Kit (Kapa Biosystems #KK2702) and terminated in the mid-exponential phase to limit over-amplification ...
-
bioRxiv - Developmental Biology 2020Quote: An antisense RNA DIG-probe was generated by transcription from linearized pCS1 vector containing Sorbs1 coding sequence using SP6 RNA polymerase kit where UTPs were labelled with digoxigenin (DIG) (Roche, 11175025910).
-
bioRxiv - Microbiology 2019Quote: PCR amplification of RNA editing containing sequence were performed by using cDNA and gDNA as templates with KAPA HiFi HotStart ReadyMix PCR kit (Roche, Germany) and the following program ...
-
bioRxiv - Genetics 2019Quote: ... Real-time PCR was performed in a final volume of 20 µl containing 20 ng of cDNA using SYBR Fast Universal qPCR Kit (Kapa Biosystems) and analyzed using the Quant Studio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: Full-length HIV clones were quantified by reverse transcriptase (RT) enzyme-linked immunosorbent assay (ELISA) (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Creatinine levels were measured with the COBAS INTEGRA Creatinine Jaffé Gen.2 Kit (Roche Diagnostics, Indianapolis, IN). To assess severity of proteinuria ...
-
bioRxiv - Microbiology 2022Quote: ... amplified using primers LN112 and LN113 (Table 2) and the PCR DIG Synthesis Kit (Roche, Basel, Switzerland) as a probe ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 1x Protease Inhibitor Cocktail (Roche). Lysates were sonicated with Sonorex Digitec (Bandelin ...
-
bioRxiv - Microbiology 2019Quote: ... containing Protease inhibitors cocktail (Complete, Roche). Resuspended A549 cells were incubated in ice for 1 h and kept in suspension by frequently vortexing ...
-
bioRxiv - Neuroscience 2022Quote: ... containing collagenase A (Roche, 1.5mg/ml) and DNAse 1 (Roche ...
-
bioRxiv - Immunology 2022Quote: ... containing protease/phosphatase inhibitor cocktail (Roche). Protein concentration was measured using a BCA assay (Pierce) ...
-
bioRxiv - Cell Biology 2019Quote: ... containing a protease inhibitor cocktail (Roche) and sodium orthovanadate (2 mM) ...
-
bioRxiv - Microbiology 2019Quote: ... containing protease inhibitors (Roche Applied Science). Tissue lysates were normalized for protein content with Pierce 660nm Protein Assay (Thermo Scientific) ...
-
bioRxiv - Immunology 2019Quote: ... containing 40 mg/L Liberase (Roche) at a rate of 5 mL/min ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing freshly added phosphatase (phosSTOP, Roche) and protease inhibitors (cOmplete EDTA-free ...
-
bioRxiv - Neuroscience 2020Quote: ... containing protease inhibitors (Complete Mini; Roche). Lysates were centrifuged (10.000g for 10 min at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... containing protease inhibitors (Complete Mini; Roche)) ...
-
bioRxiv - Cell Biology 2020Quote: ... containing protease inhibitor cocktail (Roche #11873580001). The lysates were boiled for 10 min at 95°C and clarified by centrifugation at 12 ...
-
bioRxiv - Microbiology 2020Quote: ... containing protease inhibitors (Roche, MA, USA). SARS-CoV-2 S-Ectodomain expressing Tni cell media were treated with different concentrations of bromelain (5 ...
-
bioRxiv - Neuroscience 2020Quote: ... containing a protease inhibitor cocktail (Roche) and phosphatase inhibitors (AG Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... containing an antiprotease cocktail (Roche Diagnostic). Cells were incubated for 20 minutes on a rotating wheel ...
-
bioRxiv - Neuroscience 2022Quote: ... containing protease and phosphatase inhibitors (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... D6750)] containing protease inhibitor cocktail (Roche, 04693159001) and phosphatase inhibitor cocktail (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... containing proteinase and phosphatase inhibitors (Roche), centrifuged for 10 min at 8,000 × g at 4°C and supernatant extracted and stored at −80°C ...
-
bioRxiv - Neuroscience 2021Quote: ... containing protease inhibitor cocktail (Roche #4693159001) and PhosSTOP (Roche #4906837001 ...
-
bioRxiv - Neuroscience 2020Quote: ... containing collagenase P (Roche, Penzberg, DE) (0.2 U/mL ...
-
bioRxiv - Microbiology 2021Quote: ... containing protease inhibitors (Roche Applied Science). Cell lysates were normalized for protein content with Pierce 660nm Protein Assay (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... containing 2x protease inhibitor cocktail (Roche); centrifuged at 12,000 rpm for 10 min at 4 °C to get rid of cell debris ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing protease inhibitor cocktail (Roche, 4693159001). Lysates were placed on ice for 30 minutes followed by sonication for 2 minutes with 10 seconds on/off cycle and centrifugation for 10 minutes at 10000g at 4°C in a microcentrifuge ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing protease inhibitor (Roche, Basel, Switzerland) and phosphatase inhibitor (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2019Quote: ... containing 1% RNAse inhibitor (Roche, #03335399001) and 1% DNAse I (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... containing DIG DNA-labelling mix (Roche) and primers DENV-1 3’UTR FW (AGTCAGGCCAGATTAAGCCATAGTACGG ...
-
bioRxiv - Pathology 2021Quote: ... containing complete mini protease inhibitors (Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Cell Biology 2019Quote: ... containing protease inhibitors (cOmplete tablets; Roche) and phosphatase inhibitors (PhosSTOP ...
-
bioRxiv - Biochemistry 2020Quote: ... containing 2x protease inhibitor cocktail (Roche); protein concentrations were determined by BCA assay ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 0.8U/ml Liberase TM (Roche) and 1mg/ml DNAse (Sigma) ...