Labshake search
Citations for Roche :
401 - 450 of 2693 citations for Goat Anti Rat IgG FITC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Primary antibodies used (at 1/1,000, unless specified) were rat anti-HA tag (clone 3F10, Roche), mouse anti-TY tag (27) ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: rat anti HA (1:500, Roche, #11-867-423-001), chicken anti GFP (1:800 ...
-
bioRxiv - Cell Biology 2023Quote: Antibody staining of fixed germlines was performed with 1:500 Rat anti-HA 3F10 (Roche 11867423001), 1:500 Rabbit anti-GFP (Thermo A-11122) ...
-
bioRxiv - Plant Biology 2023Quote: ... the membranes were incubated with anti-HA-peroxidase high-affinity monoclonal rat antibody (clone 3F10; Roche) 1:1000 diluted in 2.5 % (w/v ...
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies used for immunostaining included anti-HA (1:500, ROHAHA rat polyclonal, clone 3F10, Roche) and anti-GFP (1:2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins with HA-tag(s) were detected using rat mAb-anti-HA 3F10 (Roche, 1:1000) as primary antibody and IRDye® 800CW Goat anti-Rat IgG (Licor ...
-
bioRxiv - Microbiology 2024Quote: ... were stained with rat monoclonal Anti-HAHA High Affinity antibody (clone 3F10, cat. no. 11867423001, Roche). Alternatively ...
-
bioRxiv - Microbiology 2024Quote: ... Primary antibodies dilutions were as follow: high affinity rat anti-HA (clone 3F10, Roche; 1:1,000), mouse anti-FIKK4.2 (1:1,000 ...
-
bioRxiv - Cell Biology 2019Quote: ... signals were detected using anti-DIG labeled alkaline phosphatase antibody by chromogen method using NBT/BCIP (Roche). Sections were counter stained with nuclear fast red and mounted after dehydration ...
-
bioRxiv - Physiology 2022Quote: ... Detection of DIG-labeled probes was performed by incubating with anti-DIG antibody (1:2000, Roche #11093274910) in 0.1% PBST overnight at 4° C ...
-
bioRxiv - Genomics 2020Quote: ... Detection was conducted with DISCOVERY UltraMap anti-Goat multimer RUO (Roche Ventana) for 12 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... and digoxigenin (DIG)-labeled dNTPs (Roche) as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... and labeled with digoxigenin (Roche, 11175025910). Hybridization was performed with 1 to 5 μg/ml cRNA probes at 65 °C for 20 to 24 h ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... labeled with digoxigenin-11-dUTP (Roche) was used to localize 35S rDNA sites.
-
bioRxiv - Developmental Biology 2020Quote: ... with Biotin pre-labeled Uridine (Roche) and other reagents according to protocol for T7 RNA polymerase ...
-
bioRxiv - Developmental Biology 2019Quote: ... and digoxigenin (DIG)-labeled NTPs (Roche) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... and Digoxygenin (DIG) labeled dNTP’s (Roche), the resultant RNA cyp19a1 probe was then used for ISH.
-
bioRxiv - Developmental Biology 2023Quote: ... and digoxigenin (DIG)-labeled nucleotides (Roche). In situ hybridization was performed on wildtype and post-electroporation HH11-15 chicken embryos ...
-
bioRxiv - Molecular Biology 2024Quote: ... nuclei were labeled with DAPI (Roche). Immunofluorescence images were acquired using the Zeiss LSM700 confocal microscope with ZEN 2010 software.
-
bioRxiv - Neuroscience 2023Quote: ... antisense digoxigenin (DIG)-labeled riboprobes (Roche) were transcribed with SP6 or T7 RNA polymerase (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... rat α HA (Roche 3F10) was used and for AP2-I-GFP rabbit α GFP (Abcam ab290 ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were blocked for 30 minutes in 1% Roche Western Blocking Reagent prior to incubating overnight at 4°C with either anti-FITC with horseradish peroxidase conjugate (Roche) at a 1:2000 concentration or anti-DIG-with horseradish peroxidase conjugate (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... Resulting amplicons were used as templates for the synthesis of either digoxigenin (DIG) or fluorescein (FITC)-labelled anti-sense probes by in vitro transcription using T7 or T3 polymerases (Roche) and DIG or FITC RNA labelling mixes (Roche).
-
bioRxiv - Molecular Biology 2020Quote: ... and anti-rabbit/mouse IgG secondary antibody (1:2000; Roche, Cat#12015218001, Basal, Switzerland) prior to fluorescent imaging ...
-
bioRxiv - Cell Biology 2021Quote: ... A silanized grid was incubated in a drop of anti-DIG IgG (0.2µM, Roche), washed with MRB80 ...
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Genomics 2021Quote: ... and antidigoxigenin conjugated to fluorescein isothiocyanate (FITC) (Roche Diagnostics). Slides were then counterstained with DAPI ...
-
bioRxiv - Neuroscience 2021Quote: ... The following antibody cocktails were used: rat anti-HA (1:200, Cat. No. 10145700, Roche Diagnostics, USA) with rabbit anti-CamKIIα (1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... Following an overnight incubation at 4 °C with rat anti-HA (1:500, monoclonal, Roche, Cat # 11867423001) or mouse anti-GAPDH (1:25.000 ...
-
bioRxiv - Microbiology 2023Quote: ... the polyclonal murine anti N-terminal MSPDBL2 serum and a rat monoclonal α-HA antibody (Roche 3F10) were used ...
-
bioRxiv - Cell Biology 2024Quote: ... primary antibody incubation was performed in blocking buffer with anti-HA-tag (rat, Roche, 11867423001, 1:250) or anti-CD9 (mouse ...
-
bioRxiv - Molecular Biology 2021Quote: ... Chromosome were blocked in PBT containing 0.2% BSA and 5% goat serum and sequentially incubated with primary antibodies (mouse anti-PolII H5 IgM, 1:1000, Abcam, and rat anti-HA MAb 3F10, 1:50, Roche, or rabbit anti-FLAG, 1:1000, SIGMA) followed by incubation with Alexa488- and/or Alexa647-coupled secondary antibodies (Molecular Probes ...
-
bioRxiv - Immunology 2023Quote: ... only donors were included that had no history of COVID-19 as well as had tested negative in three serological assays (EuroImmun-Anti-SARS-CoV-2 ELISA IgG /S1/, Siemens Healthineers SARS-CoV-2 IgG /RBD/, and Roche Elecsys Ig /Nucleocapsid Pan Ig/). PBMC were selected from heparinized full blood by a standard density gradient (Pancoll Separating Solution ...
-
bioRxiv - Biochemistry 2022Quote: ... We incubated coverslips with primary antibodies diluted in goat serum (Anti-HA, Roche, ref #11867423001 ...
-
bioRxiv - Genetics 2019Quote: ... Coverslips were blocked in 3% BSA (wt/vol) and digoxigenin was detected with sheep anti-digoxigenin FITC 1/50 (Roche, 11207741910) followed by rabbit anti–sheep FITC 1/100 (Vector Laboratories ...
-
bioRxiv - Developmental Biology 2022Quote: ... mRNA probes labeled with digoxigenin-UTP (Roche) were synthesized from 1 μg of the above PCR product using the ampliCapTM SP6 high-yield message marker kit (Cell Script).
-
bioRxiv - Molecular Biology 2020Quote: ... Digoxygenin (DIG)-labeled DNA probes (Roche, Germany) were generated by PCR according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and screened it using DIG-labeled (Roche) PCR probes to the center of the FLC locus (primers 5’ AGTGTAACTTCAATGGCAGAAAACCCT 3’ and 5’ ATGTGGCGGTAAGCAGAGATGACC 3’) ...
-
bioRxiv - Neuroscience 2020Quote: ... and digoxygenin- or fluorescein-labeled nucleotides (Roche), and hydrolyzed to around 500 bp if needed ...
-
bioRxiv - Genomics 2019Quote: ... Digoxigenin (DIG) labeled nucleotides (Roche, Basel, Switzerland) were used to create amplified sequences with DIG labeled base pairs ...
-
bioRxiv - Developmental Biology 2023Quote: ... and digoxigenin or fluorescein labeled nucleotides (Roche). In situ hybridization was carried out using standard protocols (74) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and digoxigenin (DIG)-labeled NTPs (11277073910, Roche) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... rat α-HA (all from Roche), and α-FLAG (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: α-HA rat mAb (1/1,000) (Roche) as primary antibody ...
-
bioRxiv - Microbiology 2021Quote: ... Rat monoclonal antibody (clone 3F10, Roche) was used to detect HA-tagged proteins ...
-
bioRxiv - Microbiology 2022Quote: ... Rat monoclonal antibody (clone 3F10, Roche) was used to detect HA-tagged proteins ...
-
bioRxiv - Plant Biology 2023Quote: ... rat α-HA (Hoffmann-La Roche AG ...
-
bioRxiv - Cell Biology 2023Quote: ... rat a-HA (1:2000) (Roche), rabbit anti-aldolase (1.2000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... HA (11867423001, Roche, rat, 1:1000); HA (sc-7392 ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...