Labshake search
Citations for Roche :
401 - 450 of 2038 citations for GPN loop GTPase 3 GPN3 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Rat anti-HA antibody from Roche was used at a dilution of 1:200 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Primary antibody Anti-HA (11867423001, Roche) and secondary antibody anti-mouse HRP-labelled (A5278 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antibodies used for IFA were as follows: anti-HA monoclonal antibody (mAb) 3F10 (diluted 1:200) (Roche); mouse anti-PMV mAb (1:50) ...
-
bioRxiv - Plant Biology 2021Quote: ... Immunoblot with the anti-His-antibody conjugated to peroxidase (BMG-His-1 monoclonal antibody; Roche, Basel, Switzerland) was used to confirm the presence of enzymes.
-
bioRxiv - Cell Biology 2020Quote: The primary antibodies used in this study were as follows: mouse anti-HA antibody (Roche Life Science), mouse anti-PGK1 monoclonal antibody (Thermo Fisher/Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: Western blots were performed using the following antibodies: anti-myc antibody (Roche 0.4 mg/ml, 1/1000) followed by incubation with goat anti mouse HRP (BioRad 1/10000) ...
-
bioRxiv - Developmental Biology 2024Quote: ... the antibody incubation was performed with 1:5000 diluted Anti-Dig-AP antibody (Roche, Cat. No. 11093274910) at 4°C overnight ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by 1 hour antibody incubation (α-GFP, monoclonal mouse antibody, Roche, catalog no. 11814460001, 1:1000). After three washes with TBST for 10 min each ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics) for chromogenic detection ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg gDNA of each population was amplified using the KAPA HiFi ReadyMix PCR Kit (Roche) with the TKO outer Fw and Rv primers (Primers are listed in Supplementary Table 4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification with 21 cycles was conducted by adding 3 µL KAPA HiFi HotStart ReadyMix (Roche) and 0.05 µL IS PCR primer (10 µM ...
-
bioRxiv - Cell Biology 2024Quote: One million cells were initially lysed in 0.5% CHAPS (3-cholamidopropyl dimethylammonio 1-propanesulfonate) (Roche; #10810118001) in PBS (1x ...
-
bioRxiv - Genomics 2022Quote: ... The ConA bound nuclei were then incubated with primary antibody diluted 1:100 in Antibody Buffer (20 mM HEPES pH7.5, 150 mM NaCl, 0.5 mM spermidine, Roche Complete Protease Inhibitor Cocktail ...
-
bioRxiv - Immunology 2023Quote: The following antibodies were used for immunoblots and immunoprecipitations: anti-HA as purified antibody or matrix (3F10, Roche), anti-FLAG as purified antibody or matrix (M2 ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were then probed with the following antibodies: anti-HA-peroxidase monoclonal antibody (#12013819001, Roche, Basel, Switzerland); anti-β actin (sc-47778 HRP ...
-
bioRxiv - Plant Biology 2020Quote: ... or an anti-HA antibody (3F10; Roche).
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with anti-Digoxigenin antibody (Roche) at 4°C O/N ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of GFP antibody (Roche 11814460001) was pre-incubated with 50 μl Protein A and Protein G Sepharose (GE Healthcare 17513801 and 17061801 ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-HA monoclonal antibody (1:2000, Roche), anti-Ataxin 1 (phospho S776 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Antibodies for anti-HA-HRP (3F10, Roche), anti-Smt3 (B ...
-
bioRxiv - Genetics 2021Quote: Mouse bi-clonal anti-GFP antibody (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2020Quote: ... Flag antibody (1:1000) was from Roche, PP2Ac antibody (1:2000 ...
-
bioRxiv - Plant Biology 2020Quote: ... and incubated with anti-DIG antibody (Roche) for 2 hours at 22 °C ...
-
bioRxiv - Systems Biology 2021Quote: ... A primary antibody recognizing GFP (Roche Diagnostics) and a horseradish peroxidase-conjugated secondary antibody (Southern Biotech ...
-
bioRxiv - Neuroscience 2020Quote: ... at 2μg/ml (antibody diluent, Roche, Switzerland). The staining was completed with the Ventana XT DABMap kit and a haematoxylin counterstain ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP antibodies from Roche (11814460001, 1:2000), tubulin from Sigma (T61999 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse anti-GFP monoclonal antibody (Roche, 11814460001) was covalently coupled to magnetic beads at 12 μg antibody per 100 μL Dynabeads Protein A (ThermoFisher) ...