Labshake search
Citations for Roche :
401 - 450 of 8648 citations for 8 ETHOXYCARBONYL 6 METHOXY 7 METHYL 6H 1 2 5 OXADIAZOLO 4 3 E INDOL 3 IUM 3 OLATE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... sections are incubated with DAPI (4′,6-diamidino-2-phenylindole, Cat. no. 10236276001 Roche, Switzerland) for 10 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclear pellets were washed once with 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI) (Roche, 10236276001) in methanol (1 μg/ml) ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5% Normal Goat Serum) for 3 h at room temperature and then incubated overnight with alkaline phosphatase-conjugated anti-DIG Fab fragments (Roche, 1: 2,000) at 4°C on a shaking platform ...
-
bioRxiv - Neuroscience 2020Quote: ... 1996) on 16 µm cryosections at post-natal day 3 (P3) using anti-digoxigenin antibody (Sheep polyclonal, 1:1000, Roche, 11093274910, RRID:AB_514497). Two days exposure to alkaline phosphatase (AP ...
-
bioRxiv - Physiology 2021Quote: ... a 6.7 kb DNA fragment starting 1 kb upstream of murine Gnrhr exon 3 was amplified by PCR using the Expand Long Template PCR System (Roche, Basel, Switzerland) from 129SvEv genomic DNA using primers incorporating 5’ XmaI and 3’ NotI restriction enzyme sites (Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were lysed in 50 µl of lysis buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1× Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% BSA/TBS-T) at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... cover slips were washed with PBS and incubated for 10 min at room temperature with 1 g/mL 4’,6 diamidino-2-phenylindole (DAPI, Sigma Aldrich, Roche, #10236276001) in PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 μg/ml taxol, 3 U/ml DNAse I, 10 μg/ml RNAse A, 1 U/ml micrococcal nuclease, and Roche Complete Protease Inhibitors) and vortexed vigorously for 1 min ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Developmental Biology 2022Quote: Embryos were incubated in 1μg/ml of 4′,6-diamidino-2- 532 phenylindole (Roche, Cat# 10236276001) at RT for 10min and washed in PBS 1x ...
-
bioRxiv - Cell Biology 2020Quote: ... per sample was washed 3 times with cold 1X PBS and 2μg anti-GFP monoclonal antibody (Roche) per sample was conjugated with Dynabeads in 1ml cold PBS at 4°C for 4h ...
-
bioRxiv - Genomics 2022Quote: ... 25µl of Red ANTI-FLAG M2 Affinity Gel from SIGMA ALDRICH (F2426) were washed 3 times with TBS (50mM TRIS pH 7.5,150mM NaCl and protease inhibitor tablets [Roche]) and then added to samples ...
-
bioRxiv - Microbiology 2022Quote: ... at 37 °C for 3 hours followed by 19 μg/sample of trypsin (Roche Cat. Nr. 11418025001) at 37 °C for 13 hours ...
-
bioRxiv - Genetics 2020Quote: Exon 3 of the MSH2 gene was PCR amplified using the Expand High Fidelity PCR kit (Roche) with the following conditions ...
-
bioRxiv - Immunology 2020Quote: ... gently mechanically disaggregated and resuspended in PBS 1x containing 3 mg/ml of collagenase D (Roche Diagnostics) plus 10 μg/ml of DNAse (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... The harvested molars were pooled and dissociated with 3 U/mL Collagenase P (COLLA◻RO, ROCHE) followed by incubation for 45◻minutes in a 37°C shaking water bath ...
-
bioRxiv - Genomics 2021Quote: Mice livers were perfused and dissociated into single cells using Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) as previously described8 ...
-
bioRxiv - Plant Biology 2022Quote: ... Chloroplast were lysed osmotically in buffer 3 (25mM HEPES-KOH, pH 8.0) containing cOmplete protease inhibitor (Roche) and either separated into soluble and pellet fraction by centrifugation for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 mM MgCl2; 0.1 % NP-40; 0.2 U/µl RNaseOUT; 0.32 M Sucrose; 1x protease inhibitor, Roche) and transferred to 2 ml Dounce tissue grinder (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 ng ds-cDNA was processed for library construction using KAPA Hyper Prep Kit (Kapa Biosystems #KK8504) according to the standard protocol except that a 15-min USER enzyme (BioLab # M5505L ...
-
bioRxiv - Systems Biology 2023Quote: ... 3 mM MgCl2 and 0.1% IGEPAL CA-630) supplemented with 0.2U/µl of RNAse Protector (Roche, Switzerland), was added to each sample ...
-
bioRxiv - Genomics 2023Quote: Mastermix 3 (IS-PCR) was freshly prepared and contained 12.5 μl Kapa HiFi Hotstart Readymix (2x, Roche), 0.25 μl IS PCR Primers (10 μM ...
-
bioRxiv - Bioengineering 2022Quote: A total of 3 µL of AAV was treated with 20 units of DNase I (Roche #04716728001) at 37°C for 45 min to remove residual DNA in vector samples ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM NaCl, 3 mM MgCl2, 0.5 mM spermidine, 0.2 mM spermine, 0.01% Triton-X, 1x Roche complete protease inhibitors ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were homogenized 3 x 30s at 7000 power in a MagnaLyzer® (Roche Diagnostics, Basel, Schweiz) and placed on ice for ∼1 minute between each homogenization ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell extracts were obtained by washing 3 × in PBS and either lysing for RNA (TriPure reagent, Roche) or protein extraction (50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2023Quote: Du145 (5 × 103) and 22Rv1 (1 × 104) cells were seeded on 96-well E-Plates (Roche). Proliferation was monitored every 1 h and time dependent cell index (CI ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were then washed 2 × 5 min at 4 °C with cold 1 × PBS containing protease inhibitor cocktail (Roche, #4693132001), snap frozen and stored at −80°C until awaiting further processing ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from 3 million HEK293T cells or 0.75 million primary neurons using TriPure reagent (Roche) and purified using RNeasy MinElute Cleanup Kit (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... Dissected hippocampi were dissolved in lysis buffer (1M Tris-Cl, pH 7.5; 6M NaCl; 10% SDS; 0.5M EDTA; Triton-X 100; Phosphatase Inhibitor #3, Roche, #05-892-970-001 ...
-
bioRxiv - Microbiology 2019Quote: Cells were lysed in RIPA buffer (50 mM Tris-HCl pH7.6, 150 mM NaCl, 3 mM MgCl2, 10% glycerol, 0.5% NP-40, cOmplete EDTA-free Protease Inhibitors [Roche]) and then clarified by centrifugation at 21,000 × g for 10 min at 4°C ...
-
bioRxiv - Biophysics 2020Quote: ... The 3′ end of the 1,882-nt DNA handle was labeled with dig-ddUTP using terminal transferase (Roche), and the 798-nt DNA handle of the transcript was functionalized with biotin on the 5′ end of the PCR primer ...
-
bioRxiv - Cell Biology 2022Quote: ... The sonicated sample was layered over 3 ml of S3 solution (0.88 M sucrose, 0.5 mM MgCl2, 1x Complete protease inhibitor cocktail (Roche)) in a new Falcon tube and centrifuged at 3000 × g for 10 min at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The resuspended pellet was layered carefully over 3 ml of S2 solution (0.35 M sucrose, 0.5 mM MgCl2, 1x Complete protease inhibitor cocktail (Roche)) and centrifuged at 1430 × g for 5 min at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Positive control embryos were incubated in polymerase chain reaction buffer containing 3 U/ml DNase I recombinant (Roche) for 1 h at 37°C before adding the TUNEL reaction mix ...
-
bioRxiv - Microbiology 2022Quote: ... purified GST-RomA was incubated with equal amounts of HIS6-LphD or HIS6-LphD Y392F in protein binding buffer (25 mM Tris pH 8.0, 140 mM NaCl, 3 mM KCl, 0.1% NP40 with protease inhibitors (ROCHE)) overnight at 4°C ...
-
bioRxiv - Pathology 2020Quote: C-reactive protein was measured using the Tina-quant C-Reactive Protein Gen.3 reagent (Roche, Basel, Switzerland) designed to achieve very high sensitivity ...