Labshake search
Citations for Roche :
401 - 450 of 8748 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... cells were gently resuspended in 25 ml of swelling solution (1 mM PIPES pH 7.0, 1 mM MgCl2, 5 μg/ml taxol and Roche Complete Protease Inhibitors) and immediately centrifuged at 250 g for 3 min ...
-
bioRxiv - Plant Biology 2022Quote: ... 0.2% NP-40, 10% glycerol, 1 mM EDTA, 1 mM PMSF, 20 µM MG132, 5 mM DTT and Roche protease inhibitor #5892953001), and incubated for 1 h on a rotating wheel ...
-
bioRxiv - Plant Biology 2021Quote: Frozen inflorescence tissue was ground with liquid nitrogen and resuspended in lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 5 mM MgCl2, 10% glycerol, 1% IGEPAL, 0.5 mM DTT, 1 mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Genetics 2019Quote: ... resuspended in 60 ml hypotonic lysis buffer (20 mM HEPES-KOH pH 7.5, 5 mM NaCl, 1 mM MgCl2, 1 mM PMSF and EDTA free protease inhibitor mixture from Roche and Thermo Scientific) and incubated for 15 min on ice ...
-
bioRxiv - Developmental Biology 2024Quote: ... and incubated overnight at 4°C with anti-Digoxigenin-AP-conjugated antibody (dilution range: 1:1000 to 1:5000, Roche, catalog no. 11093274910) diluted in the same buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... 125 mM NaCl, 1% NP-40, 2 mM EDTA, 1 mM PMSF [Sigma, 93482-50ML-F], and protease inhibitor cocktail [Roche, 000000011836170001) and incubated on ice for 25 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 mM NaCl, 2 mM MgAc2, 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]). After 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 mM NaCl; 2 mM MgAc; 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]) per 1 g of cell pellet and incubated for 30 min at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 mM NaCl, 2 mM MgCl2, 10 mM NaF, 1 mM PMSF, 1% Triton X-100 and Complete Protease inhibitor mixture, Roche Diagnostics) for 45 min on ice and centrifuged at 20000g for 10 min at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 mM MgCl2) containing 4-nitro blue tetrazolium chloride (NBT, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Cell Biology 2019Quote: ... FGFR-1 and VEGFR-2 were synthesized by in vitro transcription reaction (Roche). Hydra polyps were starved for 48 hrs ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% Penicillin/Streptomycin and 20 IU human IL-2 (Roche Diagnostics, Mannheim, Germany) for 5d ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mg ml−1 iodoacetamide supplemented with Complete Protease Inhibitor Cocktail tablets (Roche) for 1 h at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mg ml−1 iodoacetamide supplemented with cOmplete Protease Inhibitor Cocktail tablets (Roche) in Dounce homogenizer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM DTT supplemented with 1×cOmplete EDTA-free protease inhibitor cocktail (Roche), 1×PhosSTOP phosphatase inhibitor (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT and 2 tablets of Complete Protease Inhibitor Cocktail Tablets (Roche) per 100 ml lysis buffer) ...
-
bioRxiv - Biochemistry 2019Quote: ... This pellet was then resuspended in Buffer A (20 mM Tris-HCl pH8.0, 1 mM EDTA, 5% glycerol, 0.1 mM PMSF, 5 mM DTT, Roche protease inhibitor cocktail) up to a volume where the conductivity of the solution was 16 mSv ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 M sucrose, 5 mM KCl, 5 mM MgCl2, 0.6% Triton X-100, 0.4 mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% glycerol with protease inhibitors (Roche, 1 tablet per 10 mL lysis buffer). Worm slurry was frozen in liquid nitrogen and stored at -80 °C until lysis ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 cOmpleteTM mini EDTA-free protease inhibitor cocktail tab per 5 ml (Roche, 0463159001), 40 U RNaseOUTTM (Thermo Fisher 10777019 ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% NP-40 and 5% glycerol) supplemented with protease inhibitors (Roche Complete EDTA-free). Protein concentrations were determined by bicinchoninic acid assay (BCA protein assay kit ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mM EDTA) supplemented with PMSF (1 mM) and Protease Inhibitor Cocktail (Roche #11836170001) followed by sonication of samples (25 % Amplitude for 10 seconds) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 5 minutes and hiPSC-CMs were dissociated using 1:200 Liberase TH (Roche) in PBS for 20 min ...
-
Transcriptional analysis in multiple barley varieties identifies signatures of waterlogging responsebioRxiv - Plant Biology 2023Quote: ... Each PCR reaction mix contained 5 μL of 2x SYBR green master 1 (Roche), 1 μL cDNA ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM EDTA) supplemented with 1 mM PMSF and protease inhibitor cocktail (Roche #11836170001). To ensure complete lysis ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were incubated overnight at 4 °C with rat anti-HA antibody (1:500 - Roche) and then with secondary goat anti-rat IgG antibody coupled to Alexa 568 (Invitrogen/Life Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated with anti-DIG-POD antibody (Roche; 1:1000 in TNB; 12 hr, 4 °C), and washed in TNT (3 × 20 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Sections were incubated overnight at 4°C with Anti-Digoxigenin-AP antibody (1:2000, Roche) in blocking solution ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were washed in MABTr and then incubated in NBT (nitro blue tetrazolium)/BCIP (bromo-chloro-indolyl-phosphate, Roche) for colour development ...
-
bioRxiv - Cancer Biology 2020Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/ml SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 0.5% SDS, 0.5% SDO, 1% Triton X-100, 1 mM PMSF, Roche cOmplete Mini Protease Inhibitors 1x), and homogenized (Precellys Evolution ...
-
bioRxiv - Biochemistry 2022Quote: ... The PVDF membrane was blocked with 5% skim milk in TBS for 1 h and incubated with anti-HA-HRP (Roche, 3F10, 1:5000) in 5% milk/TBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/mL SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: GST-tagged CBX8 was purified by re-suspending thawed cell pellets in 30 ml of lysis buffer (1× PBS, 5 mM DTT, 1× EDTA free protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN)) per liter of culture ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... in 10 ml of extraction buffer (pH 6.7) (250 mM sucrose, 120 mM KCl, 10 mM MOPS, 5 mM MgCl2, 1 mM DTT, 1 Roche protease inhibitor cocktail tablet) (Vought et al ...
-
bioRxiv - Microbiology 2023Quote: ... 720 μL concentrated solution was treated with 1000U/mL DNase I (37°C, 2h) (Roche, China) before viral DNA extraction ...
-
bioRxiv - Microbiology 2021Quote: ... monocytes were harvested using ice-cold lysis buffer (1% Triton X-100, 2% SDS, 150 mM NaCl, 10 mM HEPES, 2 mM EDTA containing protease inhibitor cocktail - Roche). Cell lysates were heated at 100 °C for 5 min in the presence of Laemmli buffer (20% β-mercaptoethanol ...
-
bioRxiv - Plant Biology 2022Quote: ... 150 mM NaCl, 20 mM KCl, 2 mM MgCl2, 1% TX-100, 40U Ribolock ml-2 and protease inhibitor cocktail, Roche) followed by clearing at 17 000 × g for 10 min at +4C° ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were stained with secondary antibodies (1:300) for 2 hours at room temperature and nuclei stained with DAPI (1:1000, Roche, Munich, Germany). The cells were mounted using the ProLong Diamond antifade mountant (Thermo ...
-
bioRxiv - Biochemistry 2022Quote: ... or octamer-mix were done at 900 MHz 1H Larmor frequency at 298 K in NMR buffer (25 mM NaPi, pH 7, 5% D2O, with 1x protease inhibitors (complete EDTA-free cocktail, Roche)) with 600 mM NaCl for the titrations with H2A-H2B and H3-H4 and 300 mM NaCl for titration with octamer-mix ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were lysed by sonication and French Press in purification buffer (50mM sodium phosphate buffer pH 7, 300 mM NaCl) supplemented with 5 ug/mL DNaseI (Roche), 5ug/mL RNAse (Sigma-Aldrich) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 μl of 10X 5-Bromo-2’-deoxyuridine (BrdU) (Roche, Germany) per well was added ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Neuroscience 2021Quote: ... 100 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 5% glycerol, and 0.1% Triton X-100 supplemented with Roche Protease Inhibitor cocktail) and then roc ked for 10 min at 4°C ...