Labshake search
Citations for Roche :
401 - 450 of 3220 citations for 6 cyano 5 methoxy 12 methylindolo 2 3 a carbazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: IL-6 release over time was studied in the Laboratoriumsmedizin of the Munich University using an ELISA (Roche, Elecsys IL-6).
-
bioRxiv - Cancer Biology 2020Quote: ... All the signals were visualized by adding 3-3′-Diaaminobenzidinetetrahydrochloride (DAB substrate) solution (Roche) to the slides and counterstained with haematoxylin ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% TritonX-100, 0.5% Na-DOC, 1 mM EDTA, 2 mM PMSF and 1x Roche protease inhibitor cocktail). After sonification for 5 min and clarification with centrifuge at 16,000 g at 4 °C ...
-
bioRxiv - Genomics 2021Quote: ... on a gentleMACS Octo Dissociator (Miltenyi) using the “Protein_01_01” protocol in MACS buffer (5 mM CaCl2, 2 mM EDTA, 1X protease inhibitor (Roche, 05-892-970-001), 300 mM MgAc ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellets were lysed in 200μL of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... resuspended in buffer F (20 mM Tris pH 7.5, 100 mM NaCl, 5 mM MgCl2, 2 mM EGTA and Roche cOmplete protease inhibitor) and lysed by fluidizer ...
-
bioRxiv - Cell Biology 2022Quote: ... and then homogenized on a gentleMACS Octo Dissociator (Miltenyi) using the “Protein_01_01” protocol with MACS buffer (5 mM CaCl2, 2 mM EDTA, 1X protease inhibitor (Roche, 05-892-970-001), 3 mM MgAc ...
-
bioRxiv - Biophysics 2021Quote: ... Cell pellets were resuspended in Lysis Buffer (25 mM HEPES pH 8.0, 250 mM NaCl, 10 mM imidazole pH 8.0, 5 mM 2-mercaptoethanol, 10% glycerol and supplemented with Roche cOmplete protease inhibitor) and sonicated ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pellet was resuspended in Buffer B (10 mM Pipes, 50 mM KCl, 5 mM MgCl2, 1 mM DTT, 2 mM PMSF, Roche protease inhibitor) with 1% Triton X-100 and incubated on ice for 1 hour ...
-
bioRxiv - Physiology 2023Quote: ... autofluorescence was quenched by treating paraffin-embedded sections with PBS/BSA (5%) for 2 h before performing TUNEL staining (Roche, Basel, Switzerland) according to the manufacturer’s protocol and using Proteinase K treatment ...
-
bioRxiv - Developmental Biology 2019Quote: ... Section permeability was improved using 12 μg/mL Proteinase-K (Roche) for 10 minutes at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid transfections were performed using FuGENE 6 (Roche Diagnostics) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... HEK293T cells were transfected using FuGENE®6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... 6 uL X-tremegene-9 transfection reagent (Roche 06365787001), 0.3 μg pCMV-VSV-G (Addgene Plasmid #8454) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’ RACE was performed with the 5’ RACE kit (Roche) using gene-specific reverse primers ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µl of 5 x KAPA HiFi buffer (Roche, #KK2101) and 16.75 µl H2O ...
-
bioRxiv - Microbiology 2021Quote: ... The infected PBMCs and CD4+ T cells were cultured at 37ºC in humidified air with 5% CO2 in the presence of 20 U/mL of IL-2 (Roche Diagnosis, Indianapolis, IN, USA), with various concentrations of S100A8 or S100A9 in RPMI-140 (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.3% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS)) supplemented with 1X protease inhibitor cocktail (Complete; Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Bioengineering 2020Quote: ... ITS (5 μg/mL insulin, 5 μg/mL transferrin and 5 ng/mL sodium selenite; Roche Diagnostics GmbH), and 5 % fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mg/ml Dispase II (Roche), and 1 mg/ml trypsin inhibitor (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and ∼3 mg DNase I (Roche). MhOR5 was extracted using 0.5% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% NP40 (Roche 11332473001), 3 µL 10% Tween-20 (Roche 11332465001) ...
-
bioRxiv - Immunology 2023Quote: ... 3 IU/mL erythropoietin (EPO; Roche), 50 ng/mL stem cell factor (SCF ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Molecular Biology 2021Quote: ... 6 mM creatine phosphate (Roche, Cat. No. 71519-72-7), 102 ng/μl creatine kinase (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 mM MES pH 6 plus protease inhibitor cocktail (Roche); lysates were centrifuged 10 min at 800xg ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesized with random p(dN)6 primers (Roche) and MMLV reverse transcriptase (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... C-33A cells were transiently transfected using FuGENE 6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... Digestion was performed with 6 units of MNase (Roche 10107921001) in 500 μl of a 20 mM Tris-HCl [pH 7.6] ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid transfections were carried out by FuGENE 6 (Roche, E269A) as per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesized with random primers p(dN)6 (Roche) using SuperScript III Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6 µl of MNase (1 mg/ml; Nuclease S7, Roche) was added to the lysate ...
-
bioRxiv - Cancer Biology 2023Quote: ... XG1 cells were supplemented with IL-6 (Roche, 3ng/ml).
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Genetics 2019Quote: ... after a 12-plex enrichment with SeqCap EZ MedExome kit (Roche, Basel, Switzerland), according to manufacturer’s specifications ...
-
bioRxiv - Microbiology 2023Quote: ... 12 µl KAPA HiFi HotStart ReadyMix (F. Hoffmann-La Roche AG, Basel, Switzerland), 2.5 µl 2 µM (bacterial and fungal ...
-
bioRxiv - Molecular Biology 2023Quote: ... Post-capture PCR (12 cycles) was performed using KAPA HiFi Hotstart ReadyMix (Roche) and xGen Library Amplification Primer Mix (IDT) ...
-
bioRxiv - Bioengineering 2023Quote: ... 12 and 14 were analyzed using a Cedex Bio Analyzer (Roche, Basel, Switzerland) to monitor glucose ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% blocking reagent (Roche) containing 2.5 μg ml-1 Cy-3-labelled telomere specific (CCCTAA ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...
-
bioRxiv - Cell Biology 2023Quote: ... X100)/5% BSA (Roche, 10735086001) for 1 hour at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...