Labshake search
Citations for Roche :
401 - 450 of 3456 citations for 6 Methyl 3 5 heptadien 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2020Quote: ... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Physiology 2021Quote: ... 60 mM of sirtinol and one protease inhibitor tablet (Roche)] and then supplemented with 200 µl 6 M urea/2 M thiourea and 900 µl lysis buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... and one tablet of phosphatase inhibitors (PhosSTOP, Roche, Basel, Switzerland) dissolved in 10 ml RIPA Buffer (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... and one Complete EDTA-free Proteinase Inhibitor Cocktail tablet (Roche)) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and one Complete EDTA-free Proteinase Inhibitor Cocktail tablet (Roche)) ...
-
bioRxiv - Systems Biology 2019Quote: ... and one tablet of the phosphatase inhibitor cocktail PhosSTOP (Roche). Cell extracts were incubated on ice 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... one cOmplete™ EDTA-free Protease Inhibitor Cocktail tablet (Roche). Lysozyme (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... one cOmplete™ EDTA-free Protease Inhibitor Cocktail tablet (Roche) per 10 ml ...
-
bioRxiv - Microbiology 2020Quote: ... One cOmplete™ULTRA protease inhibitor tablet (Roche, MA, USA) per liter was added before centrifugation ...
-
bioRxiv - Microbiology 2019Quote: ... and one cOmplete Mini EDTA-free protease inhibitor tablets (Roche) (per 10mL of buffer) ...
-
bioRxiv - Cell Biology 2021Quote: ... One unit of Anti-Digoxigenin-AP Fab fragments (Roche, 11093274910) was added to the blocking solution and incubated for 30 minutes at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4 with one EDTA-free protease inhibitor tablet (Roche) for approximately 2 g cell pellet and lysed using an Emulsiflex C3 (Avestin) ...
-
bioRxiv - Biophysics 2020Quote: ... with one cOmplete EDTA-free Protease Inhibitor Cocktail Tablet (Roche) and DNase1 at 4°C ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5 M sucrose) supplemented with one protease inhibitor tablet (Roche). Osmotic shock was performed by the addition of diluted TES buffer to release the periplasmic proteins ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5 M sucrose) supplemented with one protease inhibitor tablet (Roche). Osmotic shock was performed by the addition of diluted TES buffer to release the periplasmic proteins ...
-
bioRxiv - Neuroscience 2020Quote: ... one Complete EDTA-Free Protease Inhibitor Cocktail tablet (Roche 11873580001) per 10ml) ...
-
bioRxiv - Microbiology 2022Quote: ... pH 7.5) containing one cOmplete Mini protease inhibitor cocktail (Roche). Following three rounds of sonication (3 × 10 sec ...
-
bioRxiv - Microbiology 2021Quote: ... the Sybr Fast One-Step qRT-PCR kit (Kapa Biosystems) was used with 16S rDNA as the internal reference ...
-
bioRxiv - Biochemistry 2020Quote: ... one tablet of complete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Biochemistry 2020Quote: ... one tablet of complete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Plant Biology 2022Quote: ... plus one EDTA-free protease inhibitor tablet (Roche, Mannheim, Germany) per 50 mL of extraction buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... one tablet of cOmplete Protease Inhibitor Cocktail (Roche, cat. 4693159001) per 10 mL of the lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... pH 7.4) containing one EDTA-free protease inhibitor pill (Roche) per 25 mL and stored at −80 °C.
-
bioRxiv - Plant Biology 2023Quote: ... one-fourth of a complete proteinase inhibitor Cocktail tablet (Roche), and 50 units/mL RNase inhibitor (Sangon Biotech) ...
-
bioRxiv - Microbiology 2023Quote: ... and one anti-protease tablet (cOmplete™ ULTRA Tablets, Roche) for full-length NS5 and MTases ...
-
bioRxiv - Plant Biology 2023Quote: ... KAPA SYBR FAST One-Step RT-qPCR kit (Roche, KK4650) was used following manufacturer protocols ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.18 μL Fugene 6 reagent (Roche, Basel) was added to 4.82 μL serum free medium and incubated for 5 min at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... using random primers p(dN)6 (Roche). Quantitative PCR reactions were performed in a BioRad CFX96 system employing the SYBRgreen fluorescent reagent (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... using FuGENE® 6 (Roche, Basel, Switzerland), using standard procedures ...
-
bioRxiv - Neuroscience 2020Quote: ... using random primers p(dN)6 (Roche). Quantitative PCR reactions were performed using standard protocols using EvaGreenTM in the Stratagene Mx3000P system (Agilent Technologies) ...
-
bioRxiv - Physiology 2023Quote: ... DNA Standards 1-6 (KAPA Biosystems KK4903). The RNA-Seq libraries were normalized to a 2nM concentration and pooled for multiplexed sequencing on the NovaSeq 6000.
-
bioRxiv - Cancer Biology 2023Quote: ... the RNase A (6 µg/mL, Roche) was added or not directly to the reaction mixture ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA Standards 1-6 (KAPA Biosystems KK4903). The libraries were pooled based on equal molar amounts to 1.85 nM for multiplexed sequencing.
-
bioRxiv - Physiology 2023Quote: ... DNA Standards 1-6 (KAPA Biosystems KK4903). Libraries were pooled based on equal molar amounts to 1.9nM for multiplexed sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... using random primers p(dN)6 (Roche). Quantitative real-time PCR was performed on a real-time PCR system (Quant Studio 6 Flex ...
-
bioRxiv - Cell Biology 2024Quote: ... using random primers p(dN)6 (Roche). Quantitative real-time PCR reactions employing SYBRgreen fluorescent reagent and/or EvaGreen™ were performed in the Stratagene Mx3000P system (Agilent Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 100 mL of cold lysis buffer (50 mM HEPES pH 8, 175 mM NaCl, 5 % glycerol, 1 mM EDTA and 2 tablets of protease inhibitors by Roche). The bacterial solution was then incubated at room temperature (RT ...
-
bioRxiv - Cell Biology 2019Quote: ... and resuspended in Laemmli sample buffer (2% SDS, 5% β 50 mM Tris-Cl pH 6.8) supplemented with Protease Inhibitor Cocktail and PhosStop (Roche) for isolation of total cellular protein ...
-
bioRxiv - Developmental Biology 2021Quote: ... fixed with 0.2% gluteraldehyde/4% PFA at room temperature and incubated overnight in hybridization buffer (5% Dextran sulphate, 2% blocking powder from Roche, 5X SSC ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5 mM tris(2-carboxyethyl)phosphine (TCEP) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) and EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation and the proteins in the supernatant were purified by gravity Ni-nitrilotriacetic acid (Ni-NTA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were lysed in lysis buffer (50 mM HEPES pH 7.5, 300 mM NaCl, 10% glycerol, 2 mM DTT, 30 mM imidazole and complete EDTA-free protease inhibitors cocktail [Roche]) supplemented with 1 mM TCEP ...