Labshake search
Citations for Roche :
401 - 450 of 7464 citations for 5 Oxo 5 3 oxo 3 4 dihydro 2H quinoxalin 1 yl pentanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 5% glycerol and 1x protease inhibitor (Roche)] ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... and blocked in 5% BSA (Roche, 10735086001) in PBS solution ...
-
bioRxiv - Biochemistry 2021Quote: ... 137.5 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1 mM sodium fluoride, EDTA-free protease inhibitor cocktail [Roche]). 1 mM orthovanadate was added to the lysis buffer to prevent binding of substrates to the PTP1B trapping mutant ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were lysed in lysis buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 1 mM sodium orthovanadate and 1× complete protease inhibitor cocktail from Roche) at 4°C for 15 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... The remaining extract was centrifuged at 2,000 rpm for 5 minutes and re-suspended in 1 x PBS Lysis buffer (1 x PBS, 0.01% NP-40, 5% Glycerol, 150mM NaCl, 1 x Roche cOmplete), sonicated and stored at -20°C for downstream applications.
-
bioRxiv - Cell Biology 2023Quote: Decapsulated testis extract was re-suspended into 1 x PBS Lysis buffer (1 x PBS, 0.01% NP-40, 5% Glycerol, 150mM NaCl, 1 x Roche cOmplete) and sonicated for 20 s at 22% amplitude in cycles of 0.4 s on and 0.2 s off ...
-
bioRxiv - Microbiology 2020Quote: ... 100 mM Tris-HCl pH 8.0, 5% glycerol, 1 mM DTT, 0.1% CHAPS, 1 μg/mL avidin, cOmplete, EDTA-free protease inhibitors [Roche]), rotated at 4°C for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were grown in 10 μM BrdU:BrdC (3:1) for 16–20 h before incubation with 0.1 μg/mL colcemid (Roche) for 2-3 h ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Rap1GAP- RlucII/rGFP-CAAX + Gαi2 and D2 or PDZ-RhoGEF-RlucII/rGFP-CAAX + Gα13 and TPαR) using X-tremeGENE 9 DNA transfection reagent (3:1 reagent/DNA ratio; Roche) diluted in OptiMEM (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were harvested and lysed in IP buffer (1 x PBS, 3 mM KCl, 2.5 mM MgCl2, 0,5 % Triton X-100 and protease inhibitors from Roche). 35 μl of this lysate was loaded onto an SDS-gel (lysate lanes) ...
-
bioRxiv - Biochemistry 2020Quote: ... PFN1-KO or PFN2-KO) were split 1:3 and the next day transfected using XtremeGene 9 (Roche) with 5 μg V5-NAA80 (M23L ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... planulae were washed twice with 1/3 strength artificial seawater and incubated with 50 μg/mL liberaseTM (Roche) at 37 °C for 10–20 min with occasional pipetting ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was diluted 1:3 and qRT-PCR was conducted using a SYBR Green master mix (Roche, FSUSGMMRO) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of our samples were diluted 10 fold and 4 µl were added to a mix of 5 µl FastStart Universal SYBR Green Master (Roche, Germany), 0.4 µl of nuclease-free water and 0.3 µl of forward and reverse primer (see primer sequences in Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CBD patients were gently homogenized at 4 °C in 5 mL of TBS buffer containing one tablet of cOmplete™ mini EDTA-free protease inhibitor cocktail (Roche) at a concentration of 20% w/vol using a Dounce homogenizer ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche cOmplete EDTA-free protease inhibitor catalog # 11872580001) ...
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analysed on a LC480 instrument (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analyzed on a LC480 instrument (Roche).
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... Cells were washed in 2X PIC (Roche mini-tabs, 1 tab in 5 ml = 2X) and stored at -80°C until needed.
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mM EDTA) and freshly added PMSF (1 mM) and Protease Inhibitor Cocktail (Roche #11836170001). Equal amounts of protein (30 μg ...
-
bioRxiv - Neuroscience 2021Quote: ... S.p.a) and midazolam (0,5 mg kg −1) (Dormicum®, 5 mg/ml, Roche Pharma, Switzerland) for IM premedication before the start of the procedure ...
-
Planarians employ diverse and dynamic stem cell microenvironments to support whole-body regenerationbioRxiv - Developmental Biology 2023Quote: ... Samples were blocked in MABT containing 5% horse serum and 1% Western Blocking Reagent (Roche). In situ signals were developed as previously reported ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA diluted 1:5 in water was quantified using either SYBR Green I (Roche, # 04707516001) and a LightCycler 480 (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... and blocked for 2h at RT (2% Boehringer Blocking Reagent (Roche), 20% inactivated sheep serum in MABT) ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 2h at RT (2% Boehringer Blocking Reagent (Roche), 20% inactivated sheep serum in MABT) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM phenylmethanesulphonylfluoride (PMSF) and complete Mini protease inhibitor cocktail (Roche). Following lysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... then equilibrated for 3 min in detection buffer (Roche, Catalog# 11585762001). Signals were visualized with CDP-Star Ready-to-Use (Roche ...
-
bioRxiv - Physiology 2022Quote: ... pH 7.4) containing 3 mg/mL collagenase A (Roche Diagnostics, Germany). Oocytes of stage IV and V were manually defolliculated and each oocyte was injected with 50-100 ng of mRNA encoding for the respective photoreceptor CNG channels ...
-
bioRxiv - Neuroscience 2019Quote: ... and was subsequently digested with 3 mg/mL Collagenase/Dispase (Roche) in PBS (1X ...
-
bioRxiv - Neuroscience 2023Quote: ... with 3 mg/mL DNAse I grade II (Roche, Cat# 104159). The cell suspension was centrifuged at 1,300 rpm for 5 minutes with 7.5% BSA solution (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... and 3 cOmpleteTM mini EDTA-free Protease Inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Immunology 2023Quote: ... Fat was digested enzymatically with 3 mg/ml collagenase/dispase (Roche) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with 3 U PNGase F (Roche diagnostics) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were injected with diazepam (3 mg/kg, Roche Pharmaceuticals, CH), gaboxadol (10 mg/kg ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche), and homogenized by 10 strokes using Dounce device ...
-
bioRxiv - Immunology 2024Quote: ... in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mM MgCl2, 1 mM EGTA, 0.1% [v/v] NP-40, 1 mM DTT, 5% [v/v] glycerol, Roche Complete Protease Inhibitors and PhosSTOP Protein Phosphatase Inhibitors ...
-
bioRxiv - Microbiology 2021Quote: ... 60 mM KCl, 1 mM CaCl2, 5 mM MgCl2, 300 mM sucrose, 0.4% NP-40, 1 mM DTT, 1x Roche Complete protease inhibitors cocktail EDTA-free ...
-
bioRxiv - Microbiology 2021Quote: ... 109 CFUs of bacteria were resuspended in 150 µL of buffer TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) with 5 mg mL-1 of lysozyme (Roche) for 5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 7.5, 1 mM EDTA, 5 mM DTT, 1 mM PMSF, and complete mini protease inhibitor cocktail by Roche) and were lysed by bead-beating with chilled MiniBeadbeater (Biospec ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.5, 1 mM EGTA, 10% sucrose, 0.8 M NaCl containing sarkosyl (final 1%, w/v) and protease inhibitor (Roche). After ultracentrifugation at 135,000 × g for 20 min at 25 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 mM MgCl2, 1 mM EDTA, 1 mM DTT, 0.1% NP-40, and a protease inhibitor cocktail tablet [Roche]). After clarifying lysates by centrifugation at 2,000 rpm for 1 min at 4 °C twice ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were incubated in staining solution (1 M Tris-HCl pH 9.5, 5 M NaCl, 1 M MgCl2, NBT-BCIP, H2O) (Roche) in the dark for 10 min at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... Mitochondrial pellets were solubilized in lysis buffer with 1 % digitonin (25 mM HEPES pH 7.5, 150 mM NaCl, 5 % glycerol, 1 mM TCEP, supplemented with PhosStop (Roche), cOmplete protease inhibitor cocktail EDTA-free (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... and resuspended in lysis buffer (50 mM PBS pH 7.4, 1 mM EDTA, 5% glycerol, 1 mM PMSF and protease inhibitors from Roche). Cell lysis and protein extraction was achieved through mechanical lysis using glass beads and Precellys®24 Homogenizer (3 cycles of 30 seconds at 5500 rpm ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...