Labshake search
Citations for Roche :
401 - 450 of 8327 citations for 5 Methoxy 1 Triisopropylsilyl 1H Pyrrolo 2 3 B Pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ∼ 200 embryos of 1dpf were placed in 1mL modified Ringer’s solution (116 mM NaCl, 3 mM KCl, 4 mM CaCl2, 5 mM HEPES; pH 7.5) containing Protease Inhibitor (Roche, Cat. No. 04693132001) and Phosstop (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... was annealed with Coccus-R primer (5′–ACG– TCA–GAA–TCG–CTG–C–3′) and analyzed using FastStart Essential DNA Green Master kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 mM imidazole), and 1X with SUMO wash buffer (3 mM imidazole, 10% glycerol, 1X PBS, 2 mM DTT) + PIC (Roche 05056489001). Recombinant MYC was eluted from the beads using SUMO elution buffer (250 mM imidazole ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation to collect nuclei ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Immunology 2023Quote: ... coated with 2.5ug/mL aCD3 and re-stimulated for an additional 3 days in complete IMDM-10 supplemented with 50U/mL IL-2 (Roche 11011456001). For Th17 polarizations ...
-
bioRxiv - Biochemistry 2021Quote: ... 137.5 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1 mM sodium fluoride, EDTA-free protease inhibitor cocktail [Roche]). 1 mM orthovanadate was added to the lysis buffer to prevent binding of substrates to the PTP1B trapping mutant ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were lysed in lysis buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 1 mM sodium orthovanadate and 1× complete protease inhibitor cocktail from Roche) at 4°C for 15 minutes ...
-
bioRxiv - Cell Biology 2023Quote: Decapsulated testis extract was re-suspended into 1 x PBS Lysis buffer (1 x PBS, 0.01% NP-40, 5% Glycerol, 150mM NaCl, 1 x Roche cOmplete) and sonicated for 20 s at 22% amplitude in cycles of 0.4 s on and 0.2 s off ...
-
bioRxiv - Cell Biology 2023Quote: ... The remaining extract was centrifuged at 2,000 rpm for 5 minutes and re-suspended in 1 x PBS Lysis buffer (1 x PBS, 0.01% NP-40, 5% Glycerol, 150mM NaCl, 1 x Roche cOmplete), sonicated and stored at -20°C for downstream applications.
-
bioRxiv - Plant Biology 2021Quote: ... 1 M sucrose, 5 mM KCl, 5 mM MgCl2, 0.6% Triton X-100, 0.4 mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ml lysis buffer was made up using 5 ml RIPA buffer with 5 μl 1 M PMSF and 1x EDTA-free protease inhibitor cocktail (Roche, 11836170001). Cells were washed with 1 ml cold PBS before 250 μl lysis buffer was added to each well ...
-
bioRxiv - Microbiology 2022Quote: Fresh pre-cut pancreatic tissue (2 × 2 mm) were digested with a solution of collagenase P in HBSS-1% HEPES (0.75 mg/mL, Roche) at 37°C for 7 min with shaking ...
-
bioRxiv - Plant Biology 2023Quote: ... in 100μl extraction buffer (Tris-HCl 50 mM pH 6.8, SDS 2%, DTT 2 mM and 1× protease inhibitors (Roche) and centrifuged for 5 min at 13,000g at 4OC ...
-
bioRxiv - Biochemistry 2020Quote: ... 5% glycerol) supplemented with 1 Complete Protease Inhibitor (EDTA-free) tablet (Roche), 70 µg RNAse A (Roche) ...
-
bioRxiv - Biophysics 2021Quote: ... pH 7.6 with KOH) containing 5 mg mL−1 (type A, ROCHE). Oocytes were kept at 19 °C in a Barth’s solution (in mM ...
-
bioRxiv - Microbiology 2022Quote: ... 1% Triton X-100 and 5% glycerol) supplemented with protease inhibitor (Roche), 1 μL/mL Ready-Lyse™ Lysozyme Solution (Lucigen ...
-
bioRxiv - Cancer Biology 2020Quote: ... NE were diluted 1:5 in IP buffer with protease inhibitor (Roche). NE was incubated overnight at 4°C on rotating wheel with 10 ug of G9a antibody (Abcam ...
-
bioRxiv - Microbiology 2024Quote: ... 1% Triton X-100 and 5% glycerol) supplemented with protease inhibitor (Roche), 1 μL/mL Ready-LyseTM Lysozyme Solution (Lucigen ...
-
bioRxiv - Developmental Biology 2024Quote: ... the embryos underwent blocking with 1:5-diluted Western Blocking Solution (Roche) for 1 hour at room temperature under agitation ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mio cells were lysed in 100 μl Buffer-B (50 mM Tris-HCl, pH 8.0, 10 mM EDTA, 1% SDS, 1x Roche cOmplete protease inhibitors) and sonicated in a microtube (Covaris ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were lysed in Buffer A (2 M NaCl, 20 mM HEPES pH 7.5, 20 mM Imidazole, 5 mM βME, protease inhibitor (Roche)) by sonication ...
-
bioRxiv - Developmental Biology 2022Quote: ... DIG-labelled cDNA probe was incubated at 95 °C for 10 min and immediately placed in the ice for 5 min before adding to the hybridization buffer (5x SSC, 50 % formamide, 0.02 % SDS, 2 % blocking agent (Roche), DEPC-treated water) ...
-
bioRxiv - Neuroscience 2023Quote: ... cells and sections were processed for BrdU immunodetection following the manufacturer’s recommendations (5-Bromo-2′-deoxy- uridine Labelling and Detection Kit I, Roche). The slides were mounted for fluorescent microscopy in ProLong® Diamond Antifade Mountant with DAPI (Life Technologies).
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were washed and detection was performed at pH 9.5 by incubating in nitro blue tetrazolium and 5-bromo-4-cholro-2-indoyl phosphate solution (Roche) as per manufacturer instructions ...
-
Conserved Cis-Acting Range Extender Element Mediates Extreme Long-Range Enhancer Activity in MammalsbioRxiv - Genomics 2024Quote: ... embryos were with PBT (x3, 15mins) and incubated in prehybridization buffer (50% deionized formamide, 5× SSC, pH 4.5, 2% Roche Blocking Reagent ...
-
bioRxiv - Physiology 2024Quote: Fibroblast proliferation was assessed using a 5-bromo-2’-deoxyuridine (BrdU) incorporation assay (colorimetric) from Roche (Indianapolis, IN, USA) for 48 h following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2020Quote: ... 0.1% (v/v) 2-mercaptoethanol and 1× protease inhibitors (Roche; 11836170001). Insoluble material was removed by centrifuging at >12,000 × g for 10 min at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... or with 1:10 Dnase I (stock 2 U/μL, Roche), and micrococcal nuclease (stock 2000 U/μL ...
-
bioRxiv - Immunology 2022Quote: ... 2 ml of DMEM with 0.26 U ml−1 LiberaseTM (Roche) and 0.25 mg ml−1 DNase I (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μg ml-1 pepstatin and protease inhibitor cocktail tablets (Roche). The cells were then lysed by sonication and cell debris was removed by centrifugation at 30,000 g for 45 min at 4° C ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μg ml-1 pepstatin and protease inhibitor cocktail tablets (Roche) and lysed with an EmulsiFlex-C3 homogenizer at pressures above 20,000 psi ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 4′,6-diamidino-2-phenylindole (DAPI) (Roche, #10236276001, 1:500) with coverslips.
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM PMSF and 2 tablets cOmplete protease inhibitor (Roche #5056489001) per 50 mL of lysate ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM EDTA and 2 × Complete protease inhibitor (Roche, Indianapolis, IN) on ice for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and glands minced with surgical scissors before enzymatical dissociation for 1.5h in DMEM/F12 (1:1) supplemented with 2 mg mL−1 collagenase (Roche) + Gentamicin (Gibco) ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 25μl of 1X PCR buffer B (Kapa Biosystems, Boston, MA, USA) pre-warmed at 65°C was added then the legs were ground ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by mechanical dissociation and treatment with 0.1% collagenase B (Roche) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... the transfected cells underwent initial selection with Hygromycin B (Roche, 10843555001) and were subsequently sorted into single colonies in 96-well plates via flow cytometry.
-
bioRxiv - Developmental Biology 2023Quote: ... hiPSCs were selected with hygromycin B (50μg/ml; 843555001, Roche Diagnostics), puromycin (1μg/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were then dissociated using 0.6 mg/mL collagenase B (Roche) for 1 hour in a 37 °C incubator ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking of membranes was carried out in buffer 2 (buffer 1 plus 1% blocking reagent (Roche)) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked for 1 hr at room temperature (RT) in 3% BSA (Roche; 10735086001), 0.05% Tween (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... 3 × 104 HMEC-1 cells were seeded into an E-16 multi-well plate (Roche) in triplicate and incubated for 72 h ...