Labshake search
Citations for Roche :
401 - 450 of 8810 citations for 3 4 Hydroxy 5 isopropyl 6 oxo 1 6 dihydro pyrimidin 2 ylsulfanyl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... Glucose was then quantified by measuring NADH production using an assay based on hexokinase and glucose-6-phosphate dehydrogenase (Roche). Starch content was calculated in glucose equivalents.
-
bioRxiv - Immunology 2023Quote: HEK293 cells were seeded at 400,000 cells per well in 6-well plates and transfected the day after with indicated cDNA constructs with FuGENE6 (Roche). Reverse transfection of siRNAs was carried out using RNAiMAX according to the manufacturer’s instructions (Invitrogen Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells were seeded 72 hours prior to the experiment at 400,000 cells per well in 6-well plates and transfected the next day with wt or mutated myc-ALPK1 constructs with FuGENE6 (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Proteins were harvested from ∼30 mg of tissue (in vivo) or two 6-well plates (in vitro) and homogenised in Ripa buffer with complete mini-proteinase inhibitors (Roche). Preparation of nuclear and cytoplasmic extracts from human fibroblasts was performed using a NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2024Quote: ... TNF and IL-6 were measured by flow cytometry and plasma glucose was measured with Accu-Chek Aviva Testrips (Roche).
-
bioRxiv - Biochemistry 2024Quote: The activity assay was carried out by coupling the AK2 reaction to hexokinase (HK) and glucose-6-phosphate dehydrogenase (G6PDH, HK/G6PDH mix from Roche). In this assay ...
-
bioRxiv - Neuroscience 2024Quote: ... and Str tissue from old (N =6 wt, N =8 tgNM) mice were homogenized in RIPA buffer supplemented with protease inhibitors (Roche) and cell extracts clarified by centrifugation at 13000g for 30 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: Murine pancreatic islets were isolated by digesting the pancreas from C57BL/6 mice (10-14 weeks old) with 12mg Collagenase P (Roche) at room temperature with rotation for 35 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... EDTA-free protease inhibitor cocktail and isopropyl-β-D-thiogalactoside (IPTG) were purchased from Roche (Basel, Switzerland). A polyclonal rabbit-anti-uPA antibody (ab2412 ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.5, 150 mM NaCl, 5 mM EDTA, 2 mM ATP, 1 mM dithiothreitol and protease inhibitor cocktail tablets; Roche) using Bead Beater ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR analysis was performed by mixing 5 μL of 1 μmol·L-1 of both primers and 2.5 μL of 0.25 ng·μL-1 template DNA with 12.5 μL 2× KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland). The thermal program was 98°C for 3 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Microbiology 2024Quote: ... 1µl each of 100 µM primers Sol-PrimerA (5′-GTTTCCCACTGGAGGATA-N9-3′) and Sol-PrimerB (5′-GTTTCCCACTGGAGGATA-3′) 18 and 0.8 µl Expand High Fidelity enzyme mix (Roche, Basel, Switzerland). Reaction conditions for the PCR were ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 mM MgCl2) containing 4-nitro blue tetrazolium chloride (NBT, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Immunology 2021Quote: Total protein lysates from MDDC and cDC cultured for 1 h in the presence of media or individual or combined Poly I:C and 2′3′-di AM(PS) agonists were obtained using RIPA buffer containing 1% phosphatase and protease inhibitors (Roche Diagnostics). Subsequently ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Pathology 2023Quote: ... After addition of 4% sodium phosphotungstic acid in 170 mM MgCl2 and protease inhibitors (Complete-TM, Roche), extracts were incubated at 37 °C for 30 minutes and centrifuged at 18,000 x g for 30 minutes at 25 °C ...
-
bioRxiv - Genomics 2020Quote: ... Real-time quantitative PCR reactions were set up in triplicate with 2 μL of cDNA (1:4 dilution) per reaction using the FastStart Universal SYBR Green Master mix (Rox) (Roche) and run on a 7500 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4, 200 mM NaCl, 1% NP-40, 2 mM MgCl2, 10% glycerol, NaF +Na3VO4, complete mini tablets without EDTA, Roche). Lysates were incubated on ice for 15 minutes and centrifuged at 17,000xg at 4°C for 10 minutes ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Physiology 2024Quote: ... the samples were blocked with 5% skim milk in PBS-DEPC for 1 hour at 4°C and incubated with anti-DIG antibody (Roche Diagnostics) diluted 1:10,000 in the blocking buffer for 1 hour at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: C2 myoblasts were transfected 18-24 h after plating at 70-80% confluence by using FuGENE 6 (Roche Diagnostics, Indianapolis, IN) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Resulting cell pellets were resuspended in Buffer A (100 mM NaH2PO4, 10 mM Tris, 6 M GuHCl, 10 mM imidazole) + PIC (Roche 05056489001). Cells were sonicated 3X at 25% power for 10s (Cole-Parmer GE 130PB-1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... were added and after an additional 6 hours BrdU was added and a cell proliferation assay was performed according to the manufacturer’s instructions (Roche Applied Sciences).
-
bioRxiv - Cell Biology 2021Quote: ... cells transfected with a combination of RCAS plasmids (RCAS PDGFB-HA, RCAS shp53-RFP) using the FuGENE 6 transfection kit (Roche, 11814443001) according to the manufacturer’s protocol and as previously described 86 ...
-
bioRxiv - Microbiology 2022Quote: Mice were fasted for 6 h and baseline blood glucose levels were measured with an Accu-Check Performa blood glucose meter (Roche, USA) using blood collected from the tail vein ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragments were separated on 0.7% agarose gels buffered with 40 mM Tris-acetate at 4V/cm for 6 h and transferred overnight to nylon membranes (Roche, Switzerland) by alkaline transfer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Mitochondria were suspended in 250 µl of sonication buffer (100 mM Tris-HCl pH 7,4; 6 M guanidine hydrochloride, inhibitors of proteases cOmplete Mini (ref. 11836153001, Roche, Indianapolis, IN), inhibitors of phosphatases Phosphatase Inhibitor Cocktail I Liquid (ref ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse liver tissue was homogenized in lysis buffer (20 mM HEPES pH 8, 6 M Urea with protease inhibitors (Complete™, Roche) using a glass homogenizer ...
-
bioRxiv - Microbiology 2023Quote: ... 2% Triton X-100) containing ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail (Roche cOmplete, Sigma Aldrich)] ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 μl of 10X 5-Bromo-2’-deoxyuridine (BrdU) (Roche, Germany) per well was added ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 100 mL of cold lysis buffer (50 mM HEPES pH 8, 175 mM NaCl, 5 % glycerol, 1 mM EDTA and 2 tablets of protease inhibitors by Roche). The bacterial solution was then incubated at room temperature (RT ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5 mM tris(2-carboxyethyl)phosphine (TCEP) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) and EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation and the proteins in the supernatant were purified by gravity Ni-nitrilotriacetic acid (Ni-NTA ...
-
bioRxiv - Bioengineering 2021Quote: ... S-phase Synchronous HeLa S3 cells were washed with ice-cold 1× PBS and lysed in a swelling buffer (20 mM HEPES, pH 7.5, 2 mM MgCl2, 5 mM KCl, 1 mM Dithiothreitol [DTT], and protease inhibitor cocktail [Roche; #11836170001]) supplemented with energy-regenerating mixture ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured for 24 hours in the presence of SARS-CoV-2 specific MPs [1 μg/mL] or 5 μg/mL phytohemagglutinin (PHA, Roche) in 96-wells U-bottom plates at 1×106 PBMCs per well ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 5 mM EGTA, 1 mM DTT, 2 mM MgCl, and one EDTA-free protease inhibitor cocktail tablet; Roche) and sonicated in an ice bath for 6 minutes ...
-
bioRxiv - Immunology 2023Quote: ... tumor tissue was dissected into approximately 1– 5 mm3 fragments and digested with collagenase Type D (2 mg/ml; Roche) and DNase I (1 mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked in 5% low-fat milk in TBS-T for 2 hours and probed with 1:5000-diluted mouse anti-GFP (Roche) or rabbit anti-ATG8 (Agrisera ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Neuroscience 2024Quote: ... and BCIP (5-bromo-4-chloro-30-indoly phosphate p-toluidine salt, Roche). After development ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5% deoxycholic acid) containing inhibitors of phosphatases (1:10 PhosphoStop; Roche) and proteases (1:100 Protease Inhibitor Cocktail ...
-
bioRxiv - Microbiology 2022Quote: ... 0,002% mellitic acid and 1 pastil of protease inhibitors cocktail (Roche)).
-
bioRxiv - Biochemistry 2024Quote: ... 1 tablet crushed complete EDTA (ethylenediaminetetraacetic acid)-free protease inhibitor (Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Biophysics 2022Quote: ... 1 tablet ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche diagnostics, GmbH), pH 8) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mg.kg-1 midazolam (Dormicum, Roche), and 0.05 mg.kg-1 fentanyl (Fentanyl ...