Labshake search
Citations for Roche :
401 - 450 of 3608 citations for 10 14 Cadinene 4 5 Diol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... at 4 °C overnight and protein G-Agarose (Roche) at 4 °C for 3 h ...
-
bioRxiv - Biochemistry 2020Quote: ... 4 cOmplete EDTA-free Protease Inhibitor Cocktail tablets (Roche), 500 U benzonase ...
-
bioRxiv - Neuroscience 2020Quote: ... levodopa (Madopar®, Roche, Levodopa/carbidopa, ratio 4:1) was administered twice daily for 4-5 months at an individually-tailored dose designed to produce a full reversal of the parkinsonian condition (p.o ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 mL of Red Blood Cell Lysis Buffer (Roche) were added before being gently rocked for 10 min at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... (4) we used KAPA HiFi master mix (Roche, 07958935001) and 19 cycles of PCR.
-
bioRxiv - Cancer Biology 2024Quote: ... SDS 0.4%) + Proteinase-K 4 mg/ml (Roche, 3115887001) and incubated for 2h at 55°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μL of 20x PhosStop® phosphatase inhibitors (Roche), 4 μL of 20x cOmplete® protease inhibitors (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μL of 20x cOmplete® protease inhibitors (Roche) and 1.6 μL of 1 M DTT ...
-
bioRxiv - Developmental Biology 2022Quote: ... Antibodies were used in MABT/10% horse serum/10% Western Blocking Reagent (Sigma-Roche) at a concentration of 1:2000 for anti-digoxigenin-POD (Sigma-Roche #11207733910 RRID ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μl of 10 mM dNTPs and 10 units of Transcriptor Reverse Transcriptase (Roche).
-
bioRxiv - Developmental Biology 2024Quote: ... blocked with 10% heat-inactivated Horse serum and 10% Western Blotting Blocking Reagent (Roche). Tyramide amplification was performed by depositing 0.2% rhodamine-tyramide or fluorescein-tyramide and 0.1% 4-iodophenylboronic acid (in dimethylformamide ...
-
bioRxiv - Immunology 2020Quote: ... DNase (10 μg/ml, Roche) and dispase II (1.5 mg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg/mL insulin (Roche) and penicillin-streptomycin (100 U/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg/mL insulin (Roche), 200 μM indomethacin ...
-
bioRxiv - Immunology 2022Quote: ... 10 μg/ml DNAse (Roche) and 2% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 mM each dNTP (Roche), 1.13 mg/ml ultra-pure (non-acetylated ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 μg/μl leupeptin (Roche), and 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
A Bidirectional Switch in the Shank3 Phosphorylation State Biases Synapses toward Up or Down ScalingbioRxiv - Neuroscience 2021Quote: ... 10 µg/µl leupeptin (Roche), 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Genetics 2020Quote: ... 10 μl of Glycogene (Roche) was used per sample.
-
bioRxiv - Biochemistry 2021Quote: ... Leupeptin (10 μg/μL) (Roche), PMSF (1mM ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5μl dNTP 10 mM (Roche), 6.8 μL dH2O,0.2μL Taq Polymerase (Roche),1 μL of each primer sequence which were added to thermocycler under the conditions of initial denaturation at 95 °C for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 10 mg DNaseI (Roche) and incubated for 30 min on ice ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 mM dNTP mix (Roche), 5 μM forward and reverse primers (Metabion AG) ...
-
bioRxiv - Immunology 2022Quote: ... 10 μg/ml DNAse (Roche) and 2% FBS ...
-
bioRxiv - Immunology 2022Quote: ... 10 μg/ml DNAse (Roche) and 2% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μL DNAse I (Roche) 10 mg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 U/ml pronase (Roche) solution was added ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mM DTT (Roche Diagnostics)) and 0.1 mg/mL bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2024Quote: ... and 10 mg DNaseI (Roche) and incubated for 30 min on ice ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 mM BrdU (Roche, Germany) was added to the culture medium ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... 10 µg/ml insulin (Roche), 0.5 µg/mL hydrocortisone (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 ng.ml-1 insulin (Roche) and cultured on Collagen I (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... 10% (v/v) Ethanol (Roche) and 2% (w/v ...
-
bioRxiv - Physiology 2022Quote: ... 10 µg/ml leupeptin (Roche), and 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM DTT (Roche, 10708984001) was added to the samples ...
-
bioRxiv - Genetics 2024Quote: ... 10× conc (Roche, Basel, Switzerland) containing digoxigenin labeled uracil.
-
bioRxiv - Molecular Biology 2024Quote: ... 10 mg/mL insulin (Roche), and penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Nonidet P-40 and protease inhibitor cocktail from Roche, France), were then added to the mix and gently rotated at 4°C for 30 min ...
-
bioRxiv - Biophysics 2023Quote: ... 5% d8-13C depleted glycerol, 1 mM EDTA, 5 ug/mL of aprotinin and leupeptin and 100 µg/mL Roche protease inhibitor cocktail ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 1□mM EDTA, 1X Complete Mini protease inhibitor cocktail [Roche]). Tissues were disrupted using a mechanical homogenizer (IKA T10 basic ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mM KCl, 10mM MgCl2, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF, 1 mM TCEP, cOmplete Protease Inhibitor Cocktail, Roche) in 2 steps ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 –1 L of the crude lysates were treated with 5 mg/mL each of DNase I and RNAse (Roche) for one hour at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... uridine 5’-diphospho-N-acetyl-glucosamine (UDP-GlcNAc) and cytidine-5’-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac) were obtained from Roche Diagnostics [UDP-Gal ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...