Labshake search
Citations for Roche :
401 - 450 of 6830 citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... roots were incubated overnight at 4°C in anti-myc-mouse primary antibody (1:250, Roche in blocking solution), washed 3 times in PBST ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked in 5% milk and probed overnight at 4°C with 1:2,500 rat anti-HA mAb 3F10 (Roche). They were then incubated for an hour at RT with 1:5,000 anti-rat horseradish peroxidase conjugated antibody (GE Healthcare) ...
-
Toxoplasma GRA15 limits parasite growth in IFNγ-activated fibroblasts through TRAF ubiquitin ligasesbioRxiv - Immunology 2020Quote: ... The membrane was blotted overnight at 4°C with rat antibody against the HA tag (Roche, 1/500 dilution), TRAF2 and TRAF6 rabbit antibodies (Suppl ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated overnight at 4°C in B1 buffer with alkaline phosphatase-conjugated anti-DIG (1/2000; Roche 11633716001). After three washes in B1 buffer and one wash in B3 buffer (100 mM Tris–HCl pH 9 ...
-
bioRxiv - Genomics 2021Quote: ... Samples were then incubated overnight at 4°C with a rabbit anti-DIG HRP-conjugate antibody (1:500, Roche). Then ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4°C with 1:2000 alkaline phosphatase-conjugated anti-DIG antibodies (Sigma/Roche, 11093274910). After washes and prior to development ...
-
bioRxiv - Cell Biology 2021Quote: ... PH7.4, 150 mM NaCl, 1 mM MgCl2, 20% glycerol, 0.2% NP-40, and 1X protease inhibitor cocktail from Roche) for protein extraction ...
-
bioRxiv - Neuroscience 2021Quote: ... Tween-20 0.3%) for 1 hour and finally incubated overnight at 4°C with anti-Dig-POD antibody (Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... membranes were incubated overnight at 4°C with monoclonal mouse anti-GFP antibody (Roche; Basel, CH; dilution 1:500) or monoclonal rat anti-HA antibody (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated overnight at 4°C with anti-digoxigenin-alkaline phosphatase antibodies (1:5000; Roche; 11093274910; AB_514497) diluted in blocking solution ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1% NP40, 150 mM NaCl, 2 mM EDTA, 50 mM NaF, 0.1mM Na3VO4, 4 μg/ml leupeptin, one Roche cOmplete™ protease inhibitor tablet ...
-
bioRxiv - Biochemistry 2023Quote: ... were homogenised with 1:4 weigth per volume diethylamine (DEA) buffer (50 mM NaCl, 0.2% diethylamine, pH 10, cOmplete Protease InhibitorsTM, Roche). After 60 min at 130000xg and 4°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Tissues were washed in three changes of 0.2× SSC at 44°C for 15 minutes each and blocked in 4×SSC containing 1% blocking reagent (Roche) in 4× SSC for 1 hour at RT ...
-
bioRxiv - Immunology 2023Quote: ... Primary antibodies were incubated overnight at 4°C: rabbit anti-HA high affinity at 1:500 (Roche Diagnostics #ROAHAHA), mouse anti-FLAG M2 at 1:500 (Sigma-Aldrich #F1804) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gonadal tissues were washed three times in 0.2× SSC at 50 °C for 15 min each and transferred to 4× SSC containing 1% blocking reagent (Roche) for 1 h at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... Washed three times for 30 minutes each in TNTT at 4 ℃ to remove methanol.Blocked with 1% blocking reagents (Roche) in TNTT buffer for 2 hours at 4 ℃ to prevent no specific binding ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were then rinsed with PBS and lysed at 4°C in Buffer A (1% Triton X-100, 0.5% NaDOC and 1X cOmplete Protease Inhibitor Cocktail (Roche) in PBS) ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were resuspended in cold extraction buffer (50 mM Tris-HCl pH 7.5 containing 1 mM EDTA, 4 mM DTT, cOmplete Protease Inhibitor Cocktail (Roche), and 1 mM PSMF ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and centrifuged at 4000 rpm for 1 min at 4°C and run on the LightCycler 480 II (Roche) using the steps outlined in Supplemental Table 3.
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: Total protein lysates from MDDC and cDC cultured for 1 h in the presence of media or individual or combined Poly I:C and 2′3′-di AM(PS) agonists were obtained using RIPA buffer containing 1% phosphatase and protease inhibitors (Roche Diagnostics). Subsequently ...
-
bioRxiv - Cell Biology 2022Quote: ... The HEK 293T cells were mixed with 1 μg of mouse Ano9 cDNA (mAno9-pEGFP-N1) and 3 μl FuGene HD (Roche Diagnostics). The transfected cells were plated onto glass coverslips that were kept in a 35-mm round Petri dish ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each eluate (3 µl) was subjected to PCR amplification in 50-μl reactions containing 1 KAPA HiFi HotStart Uracil+ReadyMix (Kapa Biosystems) and 0.3 μM Dual Index primers of NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mg/ml dispase (Roche) in complete culture media for 15 min at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 mg/mL DNAase (Roche, 04716728001). The cells were resuspended by mechanical agitation through Pasteur pipettes flamed with decreasing diameters ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2024Quote: ... knee cartilage was harvested from postnatal day 3-5 mice and treated with 3 mg/ml collagenase D (11088866001, Roche) in DMEM (10569010 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Paired guide-RNA plasmids were transfected into ESCs using FUGENE 6 (Roche) transfection reagent following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was stained for 6 min with 0.5 μg/ml DAPI (Roche) and coverslips mounted in Vectashield (Vector H-1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 % Igepal CA630) supplemented with 50 μl 6 x Complete (Roche, 04693132001) and 3 μl protease inhibitor (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: U2OS cells were transfected with the indicated plasmids with Fugene 6 (Roche) according to manufacturer’s instructions using a 3:1 Fugene/plasmid ratio ...
-
bioRxiv - Systems Biology 2024Quote: ... Thereafter 10 µl of hexokinase/ glucose-6-phosphate dehydrogenase (Roche, Mannheim, Germany) was added ...
-
bioRxiv - Cell Biology 2024Quote: ... pMSCVpuro or pMSCVpuro-mRFP-EGFP-rLC3 using FuGENE® 6 (Roche, #11988387001). For the retroviral infection ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...