Labshake search
Citations for Roche :
4401 - 4450 of 6054 citations for 7 METHYL 1 INDANONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Molecular Biology 2024Quote: ... 20% v/v glycerol, 2 mM MgCl2, 0.5 mM EDTA, 0.2% NP40, 1 mM DTT, 1x Complete Protease inhibitors, Roche) and the suspension tumbled at 4 °C for 45–75 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... resuspended in buffer A complete (buffer A with 0.15% NP40, 0.5 mM DTT, 1 x Complete protease inhibitors, Roche), and dounced 40 times ...
-
bioRxiv - Molecular Biology 2024Quote: Site directed mutagenesis of plasmids listed in Table 1 was carried out using KAPA HiFi HotStart premix (Roche) or Tks Gflex DNA polymerase (Takara Bio ...
-
bioRxiv - Plant Biology 2024Quote: ... total proteins were extracted from 2-3 aliquots of 3 g frozen ground Arabidopsis seedling tissue with IP buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5% NP-40, 1% Triton-X, EDTA-free protease inhibitor cocktail [Roche]). Lysates were cleared by filtering through miracloth followed by centrifugation (6,000 g ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were homogenized in RIPA buffer (dH2O; 1% Igepal; 150 nM NaCl; 0.1% SDS; 0.5% SOD; 50 mM Tris) containing protease inhibitor (Roche) and phosphatase inhibitor (ThermoScientific ...
-
bioRxiv - Neuroscience 2023Quote: ... the brain sections were incubated with peroxidase (POD)-conjugated anti-FITC antibody (Roche Applied Science, Germany; 1:2,000) or POD-conjugated anti-Digoxigenin antibody (Roche Applied Science ...
-
bioRxiv - Genomics 2024Quote: ... Cell pellets were resuspended in 250 µL ice-cold Hi-C lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630, 1 tablet/10 mL Roche complete mini EDTA-free protease inhibitor) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The samples were de-frosted in 1 mL of 1x DpnII buffer with protease inhibitors (Roche cOmplete™), transferred to Precellys VK05 lysis tubes (Bertin Technologies ...
-
bioRxiv - Immunology 2024Quote: ... the cell pellet was re-suspended and incubated in 1 ml of Red Blood Cell Lysis Buffer (Roche) for 5 minutes ...
-
bioRxiv - Immunology 2024Quote: ... RNA was harvested by removal of culture medium and addition of 200 µl of 1 M DTT (Roche) supplement Kingfisher RNA lysis buffer (Thermofisher) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by alkaline phosphatase-conjugated anti-rabbit secondary antibodies (1:5000) and CDP-Star (0.25 mM) according to the manufacturer’s instructions (Roche).
-
bioRxiv - Immunology 2024Quote: ... nuclei were resuspended in 1mL ST buffer (nuclear flow cytometry, RNAseq experiment 2) or PBS/1% BSA/0.2UμL Protector RNAse inhibitor (Roche) (RNAseq experiment 1) ...
-
bioRxiv - Microbiology 2024Quote: ... and subsequently resuspended in 1 mL of lysis buffer (0.5% NP40, 50 mM Tris–HCl pH 7.4; 150 mM NaCl, 1 mM EDTA, cOmplete protease (Roche) and PhosSTOP phosphatase (Roche ...
-
Treatment with furosemide indirectly increases inhibitory transmission in the developing hippocampusbioRxiv - Neuroscience 2023Quote: ... 1% Triton-X100 and 1x protease and 1x phosphatase inhibitors cocktails (Complete Mini EDTA-free and phosSTOP, Roche). Lysates were cleared of debris by centrifugation (14,000 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... keratinocytes were lysed in 1× RIPA buffer (details) supplemented with a protease-inhibitor-cocktail (Roche, Burgess Hill, UK). Lysates were subjected to 10% SDS-PAGE ...
-
bioRxiv - Genetics 2023Quote: The beads were resuspended in 50 µL PCR mix including 1× HiFi HotStart Readymix (Kapa Biosystems, cat #KK2602) and 0.8 μM ISPCR oligo (AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sequencing libraries were prepared from 1 µg of total RNA using a Kapa mRNA HyperPrep kit (Roche, KK8580) per the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2024Quote: ... The purified parasites were lysed in 200 μl RIPA buffer (150mM NaCl, 10 mM TrisHCl, pH 7.5, 0.1% SDS, 1% TX100 containing 2x protease inhibitor cocktail (Roche), and 1 mM PMSF ...
-
bioRxiv - Biophysics 2024Quote: ... A second PCR amplification was performed with KAPA HiFi (KAPA Biosystems; 1-μL qPCR template, 15 cycles maximum). We amplified corresponding regions of pSC101_TetR_specR with primers that linearized the backbone ...
-
bioRxiv - Molecular Biology 2022Quote: ... with modifications - membranes were pre-hybridized in a volume of 0.2ml of pre-hybridization solution (5xSSC, 0.1% N-Lauroylsarcosine sodium salt, 1% SDS, 2% Blocking reagent (Roche)) for each 1cm2 of the membrane ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100) complemented with final concentration of 1X EDTA-free Complete protease inhibitor cocktail (34044100, Roche) and 1 mM PMSF (78830 ...
-
bioRxiv - Immunology 2023Quote: ... and the surface was immersed in 200 µl of ice-cooled gut buffer [1× protease inhibitor cocktail (Roche), 0.2 mg/mL trypsin inhibitor from soybean (Thermo fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were then resuspended in sonication buffer (50 mM Tris-HCl pH 8.1; 10 mm EDTA; 1% Triton-X; 0,1% deoxycholate sodium; 100 mM NaCl, 1mM PMSF, Proteinase inhibitor Roche) and sonicated 6 times with 2 min cycles (Branson Sonifier 250 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Riboprobes produced as described above were detected using alkaline-phosphatase-conjugated anti-digoxigenin Fab fragments (1:2000, [Roche]). Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP ...
-
bioRxiv - Pathology 2023Quote: ... The slides were steamed for 32 minutes in Cell Conditioning 1 (CC1) solution (Cat. # 950-500, Roche Diagnostics) for antigen retrieval ...
-
bioRxiv - Neuroscience 2023Quote: ... brain sections were incubated with horseradish peroxidase (HRP)-conjugated anti-Dig (Roche Applied Science cat#11207733910, 1:500) and anti-GFP (Aves Labs cat#GFP-1010 ...
-
bioRxiv - Plant Biology 2023Quote: ... membranes were cut and immunodetected with either Horse Radish Peroxidase (HRP)-conjugated 3F10 anti-HA (1:2000, Roche) or HRP-conjugated Flag M2 (1:2000 ...
-
bioRxiv - Immunology 2023Quote: ... Lungs were perfused with sterile PBS and digested for 1 hour with 625µg/mL collagenase D (Roche 11088875103) and 75U/mL DNase I (Sigma D4527) ...
-
bioRxiv - Neuroscience 2023Quote: Tissues were diluted in RIPA buffer (50 mM Tris pH 8.0, 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 1% Triton-X100, freshly added protease/phosphatase inhibitors [Roche]), and homogenised using stainless steel beads and a QIAGEN TissueLyser II (shaking 1 min ...
-
bioRxiv - Plant Biology 2023Quote: Total proteins were extracted from 6 g of frozen ground Arabidopsis seedling tissue with IP buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5% NP-40, 1% Triton, EDTA-free protease inhibitor cocktail [Roche]). Lysates were cleared by centrifugation (6,000 g ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mM EDTA and 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets Roche). Bacterial cells were lysed with a M110-P microfluidizer (Microfluidics ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation was performed at 4 °C for 1 h with pre-conjugated anti-HA affinity matrix (Roche 11815016001) or Anti-GFP Agarose (RQ2 ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with DNAse I (4 U/ul) and 1 cOmpleteTM mini EDTA-free protease inhibitor cocktail tablet (Roche). The sample was lysed by French press at 17 KPsi (Constant Systems Ltd) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hearts were cut into 1–2 mm3 pieces and incubated with 0.5 U/mL collagenase B (Roche #11088807001) in 0.2% NaN3/PBS and left to oscillate at 1000 rpm at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1% Triton X-100) supplemented with 1X complete protease inhibitor cocktail and 1X complete phosphatase inhibitor cocktail (Roche) using a Precellys Evolution homogenizer (Bertin Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... beads were washed thoroughly with digitonin buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Plant Biology 2023Quote: ... cells were ruptured by bead beating in lysis buffer (50 mM Tris-pH 8.0, 1 mM DTT, 0.5 mM PMSF and 2x PhosStop EASYpack-Roche) for 7 cycles with 30 seconds of beating at 400 rpm and 45 seconds on ice for each cycle ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies used in this study and their respective dilutions were: mouse monoclonal anti-GFP at 1/1000 (clones 7.1 and 13.1, Roche), mouse monoclonal anti-TY at 1/200 (53) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the mixture was resuspended in buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were washed thoroughly with digitonin buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1× Roche cOmplete protease inhibitors ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were washed three times (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-7 washing steps with wash buffer (25 mM Hepes pH 7.4; 150mM NaCl; 0.5mM EDTA pH 8.0; 1 mM DTT and ½ tablet of proteinase inhibitor cocktail, Roche 11836170001) were performed before the beads were either sent for mass spectrometry or prepared with the appropriate amount of SDS for SDS/PAGE and Western blot ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were washed with 0.1% PBST and incubated with anti-Fluorescein-POD antibodies (1:500; Roche, #11426346910) in 1% blocking buffer overnight at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies used in this study and their respective dilutions were mouse monoclonal anti-GFP at 1/1000 (clones 7.1 and 13.1, Roche), mouse monoclonal anti-TY at 1/250 (53) ...
-
bioRxiv - Biochemistry 2023Quote: ... 30% glycerol [w/vol] and bromophenol blue) and 1 µl of proteinase K (14–22 mg/ml, Roche) and incubating at 37 °C for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... the cells were lysed in 1 ml of mild lysis buffer containing protease inhibitor mixture (Roche Life Sciences) and phosphatase inhibitor mixture (EMD Millipore) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysis was performed with Buffer NP40 (50mM Hepes pH 7.5, 150mM KCl, 2mM EDTA, 0.5% NP40, 1mM DTT, and 1 Roche protease inhibitor tablet for 10 mL of buffer).
-
bioRxiv - Cell Biology 2023Quote: Cells were re-suspended in 0.1% NP-40-PBS (1ml/1×107 cells) with 1X Protease Inhibitors (Roche) and 1mM DTT ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris-HCl pH 8.0, 5 mM MgCl2, 0.25% IGEPAL CA-630, 1 mM DTT, cOmplete protease inhibitor [Roche]) and mixed with 200 µL of 3 µg µL−1 nuclear extract and 500 µL PBB+ buffer ...