Labshake search
Citations for Roche :
4301 - 4350 of 7428 citations for Urea Nitrogen BUN Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-seq libraries were prepared using the KAPA Stranded mRNA-Seq Kit (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The shotgun sequencing library was constructed using the KAPA Hyper Prep Kit (Roche). Libraries were sequenced on the DNBSEQ-G400 (BGI ...
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were prepared by using the KAPA HyperPrep kit (Roche, Basel, Switzerland, # 7962363001) according to the manufacturer’s specifications ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR was performed using the FastStart Essential DNA Green Master kit (Roche, 06924204001) on LightCycler® 96 instrument (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was extracted using the High Pure RNA isolation kit (Roche Molecular Systems) according to manufacturer’s instructions and following the general precautions required for RNA work (39) ...
-
bioRxiv - Genomics 2022Quote: ... The DNA fragments were prepared with the KAPA HTP Library Preparation Kit (Roche) for sequencing ...
-
bioRxiv - Genomics 2022Quote: ... and libraries prepared using the KAPA Hyper Prep kit for DNA (Roche KK8504). Truncated universal stub adapters were ligated to DNA fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library enrichment was performed with the KAPA HotStart PCR kit (Roche Diagnostics KK2502) in 50 μl of total reaction volume (10 μl 5X KAPA buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... We measured ATP concentration with the “ATP bioluminescence assay kit HS II” (Roche) according to the manufacturer instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNA was synthesized with Transcriptor First Strand cDNA synthesis kit (Roche, Basel, Switzerland). qPCR experiments were performed using QuantStudio 5 Real-time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Library preparation was done with the KAPA DNA or RNA Hyperprep kit (Roche). Ligation was made with Illumina dual-index UMI (IDT) ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified by qPCR using a KAPA Library Quant Kit (KAPA Biosystems). Normalized libraries were pooled ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified by qPCR using a KAPA Library Quant Kit (KAPA Biosystems). Normalized libraries were pooled (2.5nM) ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified by qPCR using a KAPA Library Quant Kit (KAPA Biosystems). Normalized libraries were pooled (0.23nM) ...
-
bioRxiv - Genomics 2022Quote: ... Linear NGS library construction was performed using a KAPA HyperPrep library kit (Roche) according to published protocols ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were constructed using the Kapa HIFI HotStart ReadyMix PCR Kit (KAPA Biosystems). Nucleic acid purification was performed using SPRI Select (BECKMAN COULTER) ...
-
bioRxiv - Genomics 2022Quote: ... constructed barcoded libraries for sequencing using KAPA HyperPrep kits (Roche Sequencing, Pleasanton, CA) with a target fragment size of 500 bp ...
-
bioRxiv - Genetics 2022Quote: ... Library preparation was performed using a commercially available kit provided by KAPA Biosystems (KAPA Hyper Prep with Library Amplification Primer Mix ...
-
bioRxiv - Genomics 2022Quote: Libraries are quantified via qPCR using the KAPA Library Quantification Kit (Roche 0796020400), which specifically analyzes sequencing-competent fragments ...
-
bioRxiv - Genomics 2022Quote: BANC-seq libraries were prepared using the Kapa Hyper Prep Kit (Kapa Biosystems) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was done with the SYBR Green I Master kit (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The KAPA HiFi Hot Start Ready Mix kit (Kapa Biosystems, Woburn, MA, USA) was used for PCR amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified cDNA was subjected to PCR amplification using KAPA Library Amplification Kits (Roche) with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ ...
-
bioRxiv - Microbiology 2022Quote: ... JE1 amylase activities were measured in culture supernatants using the AMYL kit (Roche/Hitachi #11876473 001 ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was generated by using the Transcriptor First Strand cDNA Synthesis Kit (Roche). qPCR was performed using FastStart SYBR green master mix (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted with the High Pure PCR Template Preparation kit (Roche) from cells collected 72 hours after transfection.
-
bioRxiv - Pathology 2022Quote: ... and quantified using the KAPA Library quantification kit for Illumina platforms (KAPA Biosystems). One hundred base pair single-read sequencing of multiplexed samples was performed on an Illumina HiSeq 4000 sequencer ...
-
bioRxiv - Plant Biology 2022Quote: ... The library was quantified with the KAPA Library Quantification Kit (Roche, Basel, Switzerland), and the fragment size of the library was verified using an Agilent Technology 2100 bioanalyzer ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mRNA was isolated with an mRNA Isolation Kit (Roche, # 11 741 985 001) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the LightCycler Fast Start DNA Master SYBR Green I kit (Roche Diagnostics) as previously described (Maire et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... The libraries were constructed using the KAPA HyperPlus Library Preparation Kit (KAPA Biosystems) and sequenced using the Illumina HiSeq 4000 platform (with 150 bp paired-end reads) ...
-
bioRxiv - Microbiology 2023Quote: ... with a KABA SYBR Fast Universal qPCR Kit (Kapa Biosystems, Wilmington, MA, USA) was used for quantification ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were quantified using the KAPA qPCR quantification kit (KAPA Biosystems, Wilmington, MA) and sequenced on an Illumina HiSeq 2500 producing single end 50 base pair reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the LightCycler FastStart DNA Master SYBR Green I kit (Roche Diagnostics, 03003230001). The amplification condition for Oct3/4 was 10 min at 95ºC for one cycle ...
-
bioRxiv - Microbiology 2022Quote: ... using commercial kits adapted for a COBAS 6000 autoanalyzer (Roche Diagnostics, Rotkreuz, Switzerland). Radiolabeled HDLs were prepared as previously described24 ...
-
bioRxiv - Microbiology 2022Quote: ... the cell viability was assessed by using the XTT kit (Roche Applied Science) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Hybridization reactions were washed using SeqCap Hybridization and Wash Kit (Roche, Cat#: 05634261001) and DNA eluted in 50μL molecular grade water ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA extraction was performed by using the HighPure FFPET RNA extraction kit (Roche). RNA concentration and quality were assessed on the Agilent Bioanalyzer ...
-
bioRxiv - Microbiology 2022Quote: ... DNA libraries were quantified via qPCR using a KAPA Library Quantification kit (Roche Sequencing and Life Science ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted using the HighPure RNA Isolation kit (Roche, Mannheim, Germany; # 11828665001) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Digoxigenin-labelled RNA probes were prepared using a DIG Northern Starter Kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA probe was labelled using a DIG oligonucleotide tailing kit (Roche, Germany), as per the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... Reaction was performed with FastStart Universal SYBR Green Master Kit with Rox (Roche). Normalized to expression of HPRT level ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted with the High Pure miRNA Isolation Kit (Roche Diagnostics) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... and cDNA was synthesized using a Transcriptor first-strand cDNA synthesis kit (Roche) and RT-qPCR was performed using SYBR green master mix (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and cDNA was synthesized using a Transcriptor first-strand cDNA synthesis kit (Roche). Primers for fur (Table 1 ...
-
bioRxiv - Microbiology 2024Quote: ... These libraries were prepared with the Kapa Hyper Stranded mRNA library kit (Roche). All samples were pooled and run on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... The prepared libraries were then quantified using KAPA Illumina library quantification kit (Roche) and run on a LightCycler 480 real-time PCR instrument (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was amplified using the 2X KAPA Taq ReadyMix PCR Kit (KAPA Biosystems, now Roche Sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: NB was performed according to the manufacturer’s protocol (DIG Northern Starter Kit, Roche). Digoxigenin (Dig)-labeled antisense riboprobes were produced using using T7 RNA polymerase by in vitro transcription with RiboMAX Large Scale RNA Production Systems (Promega) ...