Labshake search
Citations for Roche :
4201 - 4250 of 5576 citations for Mouse Legumain ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... RNA was manually extracted from fluid samples (CSF or blood serum) using the High Pure Viral RNA Kit (Roche). RNA was then subjected to reverse transcription and quantitative PCR using primers and a fluorescently conjugated probe on an Applied Biosystems 7900 instrument.
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR reaction was prepared using a LightCycler® 480 SYBR Green I Master kit (Roche Diagnostics, Mannheim, Germany) and the PCR was performed with a LightCycler® 480 Instrument II (384-well ...
-
bioRxiv - Molecular Biology 2019Quote: ... Diluted extracts were amplified in 12 parallel reactions using the Transcriptor One-step RT-PCR kit (Roche, Basel, Switzerland) for reverse-transcription and first-round PCR ...
-
bioRxiv - Cancer Biology 2019Quote: Quantification of libraries was performed by quantitative polymerase chain reaction (qPCR) using the KAPA Library Quantification kit (KAPA Biosystems). Library fragment size was determined by the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: ... The barcoded sequencing libraries were quantified by quantitative PCR using the KAPA Library Quantification Kit (KAPA Biosystems, Wilmington, MA). Sequencing libraries were sequenced using Novaseq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2019Quote: ... The concentration of indexed libraries was quantified by RT–qPCR using the Universal Kapa Library Quantification Kit (KAPA Biosystems). Final libraries were normalized and sequenced on an Illumina HiSeq 2000 sequencer.
-
bioRxiv - Cancer Biology 2019Quote: ... DNA sequencing libraries were prepared for tumor and matched-normal DNA using the KAPA Hyper prep kit (Roche, USA); tumor RNA-Seq libraries were prepared using KAPA Stranded RNA-Seq with RiboErase kit ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Washing and detection steps were carried out as outlined in the manufacturer’s protocol for the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche).
-
bioRxiv - Neuroscience 2020Quote: TUNEL assay (90) was performed using an in situ cell death detection kit conjugated with fluorescein isothiocyanate (Roche, 11684795910). DAPI (Vectashield Antifade Mounting Medium with DAPI ...
-
bioRxiv - Genomics 2020Quote: ... was generated with KAPA Hyperprep Stranded mRNA-seq library kits (Roche Sequencing and Life Science, Kapa Biosystems, Wilmington, MA) and sequenced with a Novaseq 6000 using 150bp paired end reads.
-
bioRxiv - Plant Biology 2020Quote: ... A 1 µg RNA was used to synthesize cDNA using a first-stand cDNA synthesis kit (Roche Diagnostics, Switzerland). The cDNA was normalized to 100 ng µl−1 and used for PCR analysis in a 10 µl reaction with gene-specific primers (5‘-CGTGGGATACCCTTACATGG and 5‘-CCCGATTATCTTCCACCAGA for ZmOMT1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... up to 5 ng/sample of ChIP was prepared for sequencing using the Kapa Hyper-prep Kit (Kapa Biosystems) using NEXTflex adapters (Bio Scientific) ...
-
bioRxiv - Genomics 2019Quote: ... Cells were then harvested and genomic DNA was extracted with a High Pure PCR Template Preparation Kit (Roche 11796828001). MinION runs were performed on R9 with 400-500ng purified DNA per sample following library preparation with Ligation Sequencing Kit 1D (ONT SQK-LSK108) ...
-
bioRxiv - Immunology 2020Quote: ... genes of SARS-CoV-2 was performed using the LightMix Modular SARS and Wuhan CoV E-gene Kit (TIB MOBIOL, Synheselabor GmbH, Berlin, Germany) in a LightCycler 480 II system following the manufacturer’s recommendation (Roche Diagnostics International Ltd. ...
-
bioRxiv - Cell Biology 2020Quote: ... Apoptotic cells were detected in dissected guts using the TMR red In Situ Cell Death Detection Kit (Roche; 12156792910) following standard kit staining protocol ...
-
bioRxiv - Genomics 2020Quote: ... Bisulfite converted DNA was then used as template for PCR amplification with KAPA HiFi HotStart Uracil kit (Roche, KK2801) using primers surrounding Site 1 in intron 8 of the Fto gene ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The pooled and purified library was quantified using the Universal KAPA Library Quantification kit for Illumina platforms (Roche, # KK4824). The pooled TempO-Seq® library was sequenced in-house using the NextSeq® 500/550 High Output Kits v2 (75 cycles ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was fragmented to 100-300bp and libraries were constructed using the KAPA HTP Library Kits (KAPA Biosystems). A single low input sample used the Swift Accel-NGS 2S DNA Library Kit (Swift BioSciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... and quantitative RT-PCR for library quantification was performed using the Kapa Library Quantification Kit (Roche Sequencing, Pleasanton, CA). The libraries were sequenced on the Illumina NextSeq 500 v2 sequencer with a 75-base paired-end run in order to generate about 40 million read pairs per sample.
-
bioRxiv - Genomics 2019Quote: All 5’ fragments were amplified off the array using HSSF-ATGC and DO_15R_PU (Supplemental Table 8) with KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (Kapa Biosystems) and stopped before plateauing ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were prepared using a miniaturized version of the Kapa HyperPlus Illumina-compatible library prep kit (Kapa Biosystems). DNA extracts were normalized to 5 ng total input per sample using an Echo 550 acoustic liquid handling robot (Labcyte Inc) ...
-
bioRxiv - Microbiology 2021Quote: ... shotgun library construction was performed for the extracted DNA using a KAPA Hyper Prep kit for Illumina (KAPA Biosystems), and sequencing of the library was performed on an Illumina MiSeq platform (MiSeq PE300) ...
-
bioRxiv - Genetics 2020Quote: ... 400ng of total RNA (RIN >6) was used to generate polyA-selected libraries with Kapa mRNA HyperPrep kits (Roche) with indexed adaptors ...
-
bioRxiv - Molecular Biology 2020Quote: ... The digested RNA samples were then analyzed by electrophoresis (5.5% PAGE with 8 M urea) and northern blotting using the DIG Northern Starter Kit (Roche). Poly(A ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were pooled at equimolar concentrations then the pool was quantitated using the KAPA library quantification kit (KAPA Biosystems). Libraries were sequenced single end 75 base pairs using NextSeq500 (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... the libraries were prepared from 500 pg of immunoprecipitated DNA fragments using the KAPA Hyper Prep Kit (KAPA Biosystems). The libraries were applied to Single-end sequencing for 93 cycles on HiSeq2500 (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... Viral RNA was extracted from swab samples or homogenized tissues using a High Pure Viral RNA Kit (Roche, Germany). Reverse transcription and TaqMan quantitative PCR were performed using a probe one-step real-time quantitative PCR kit (TOYOBO ...
-
bioRxiv - Plant Biology 2021Quote: ... One microgram of each RNA sample was used for library construction using the KAPA mRNA HyperPrep Kit (KAPA Biosystems). Eighteen libraries differentially indexed using the FastGene Adaptor kit (Nippon Genetics ...
-
bioRxiv - Immunology 2020Quote: ... The library was constructed following the manufacturer protocol of the KAPA LTP Library Preparation Kit (KAPA Biosystems, Roche, Switzerland). ChIP DNA libraries were ligated with the Bioo scientific barcoded adaptors (BIOO Scientific ...
-
bioRxiv - Immunology 2020Quote: ... The library was constructed following the manufacturer protocol of the KAPA LTP Library Preparation Kit (KAPA Biosystems, Roche, Switzerland). ChIP DNA libraries were ligated with the Bioo scientific barcoded adaptors (BIOO Scientific ...
-
bioRxiv - Genetics 2020Quote: ... Southern blot was performed according to the manufacturer’s protocol of DIG HIGH prime DNA labeling and detection starter kit 1 (Roche). 10 µg aliquot of genomic DNA was digested overnight with DraIII ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries were prepared from high-quality RNA samples (RIN scores >9.0) with KAPA Stranded RNA-seq Kit with RiboErase (Roche). Paired 150-bp reads (21.2 - 118.8 million reads per sample ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Detection of the respective bands was carried out by the Dig DNA labeling and detection kit (Roche, Penzberg, Germany) according to the manufacturers instructions.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Antisense Digoxygenin-UTP riboprobes were synthesized using SP6 or T7 RNA polymerases and the DIG RNA Labeling kit (Roche).
-
bioRxiv - Cell Biology 2021Quote: TUNEL assay [47] was performed using an in situ cell death detection kit conjugated with fluorescein isothiocyanate (Roche, 11684795910). DAPI (Vectashield Antifade Mounting Medium with DAPI ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA-seq libraries were prepared from 100 ng of total RNA using RNA HyerPrep kit with RiboErase (Kapa Biosystems). Sequencing was performed at the MD Anderson core facility equipped with an Illumina HiSeq 4000 instrument ...
-
bioRxiv - Genomics 2021Quote: ... We performed capture-based target enrichment using the SeqCap EZ Hybridization and Wash Kit (Roche NimbleGen, Madison, WI, U.S.). We then used the sequencing platform ...
-
bioRxiv - Genomics 2021Quote: ... Pre-capture libraries were prepared from up to 100 ng input genomic DNA using the Kapa Hyperplus kit (Roche), using a fragmentation time of 8 minutes and standard-chemistry end repair/A-tailing ...
-
bioRxiv - Genomics 2020Quote: ... The fragmented DNA was then ligated with dual-indices using a KAPA Hyper prep PCR-free library kit (Roche) according to the manufacturer’s directions ...
-
bioRxiv - Zoology 2021Quote: ... nasal and tonsil swab) to a final elution volume of 80ul using MagNA Pure LC RNA isolation kit (Roche) and the KingsFisher Flex 96 robot (Thermofisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... The barcoded sequencing libraries were quantified by quantitative PCR using the KAPA Library Quantification Kit (KAPA Biosystems, Wilmington, MA). Sequencing libraries were loaded on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... Library preparation was carried out with 500 ng sheared DNA using Kapa Hyper library prep kit (Roche, Basel, Switzerland). Barcodes were added using the Illumina UD 96 index kit (Illumina) ...
-
bioRxiv - Immunology 2020Quote: ... The isotypes of anti-Drosophila antibodies were determined by the IsoStrip™ Antibody Isotyping Kit (11493027001 Roche, Basel, Switzerland) according to the instructions of the manufacturer.
-
bioRxiv - Immunology 2021Quote: ... The PCR products were used to synthesize dsRNA using a T7 RNA Polymerase Kit (Sigma-Aldrich RPOLT7-RO ROCHE). Generated dsRNAs were treated with TURBO DNA-free Kit (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... 1 μg of total RNA was reverse transcribed using a Transcriptor First Strand cDNA synthesis kit (Roche Applied Science) and the provided random hexamer primers for the mix preparation ...
-
bioRxiv - Genomics 2020Quote: ... An Illumina compatible NGS library was then prepared with 50ng of genomic DNA using the KAPA HyperPlus kit (Roche). Sequencing was performed on a NextSeq500 instrument (Illumina) ...
-
bioRxiv - Immunology 2020Quote: ... Stranded RNA libraries were prepared with 100ng total RNA using the KAPA RNA HyperPrep Kit with RiboErase (HMR) (Roche). RNA sequencing was performed on Illumina NovaSeq 6000 system (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted from BHI broth cultures using the High Pure PCR template preparation kit (Roche, Potsdam, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... The library concentration was determined by qPCR using the Library Quantification Kit Illumina Platforms (Kapa Biosystems, Boston, MA, USA). An equimolar pool of the barcoded libraries was made and the pool was sequencing on a HiSeq 2500 system (Illumina ...