Labshake search
Citations for Roche :
4051 - 4100 of 5262 citations for Nucleic Acid Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Library concentrations were also assessed by qPCR using the KAPA Library Quantification Kit (Complete, Universal) (Kapa Biosystems, Woburn, MA). Pooled libraries were sequenced on an Illumina NovaSeq 6000 using 150bp PE reads (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: RNA extraction from A549 cells grown in 6-well plates was done using High Pure RNA isolation kit (Roche). Transcriptor First strand kit (Roche ...
-
bioRxiv - Physiology 2023Quote: ... Cell apoptosis was measured using an in situ cell death detection kit and following the manufacturer protocol (Roche, 12156792910). Images were obtained using an inverted fluorescent microscope (Leica DMi8 ...
-
bioRxiv - Cell Biology 2023Quote: MTT activity was determined using the Cell Proliferation Kit I according to the recommendations of the manufacturer (Roche, Spain). Optical density was determined at 575[nm with a reference wavelength of 690[nm using a Varioskan Flash spectrophotometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... The concentration of each captured library pool was accurately determined through qPCR utilizing the KAPA library Quantification Kit according to the manufacturer’s protocol (Roche) to produce cluster counts appropriate for the Illumina NovaSeq-6000 instrument ...
-
bioRxiv - Cell Biology 2023Quote: ... The ribodepletion method of library preparation for RNA sequencing was performed using the Total-RNASeq RiboErase Kit (KAPA Biosystems). All RNA samples were loaded two separate 2-lane flow cells and sequenced using an Illumina HiSeq 2500 system generating 51 bp paired-end reads ...
-
bioRxiv - Genomics 2023Quote: ... Adapter-ligated material was amplified with 12-14 cycles of PCR using KAPA HiFi HotStart PCR Kit (Roche, 07958897001) and universal P5/P7 Illumina primers (see Golov et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA (1Lμg) was used to generate RNA-seq library with KAPA HyperPrep RNA Kits with RiboErase (Roche KK8560) using 8 cycles of PCR amplification ...
-
bioRxiv - Microbiology 2023Quote: Sequencing was done using Illumina HiSeq X with sequencing shotgun library preparation using the KAPA HyperPrep Kit (Kapa Biosystems) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... TUNEL staining was performed as in (46) using the TMR red in situ cell death detection kit (Roche, 12156792910).
-
bioRxiv - Evolutionary Biology 2023Quote: ... and long-read (Nanopore) platforms: the Illumina library was prepared using the Kapa HyperPrep kit (Kapa Biosystems, Wilmington, MA). A-tailing ...
-
bioRxiv - Developmental Biology 2023Quote: ... We synthesized digoxigenin (DIG)-labeled sense and antisense RNA probes using a DIG RNA Labeling Kit (Roche, Basel, Switzerland) after digestion with the appropriate restriction enzymes BamHⅠ-HF ...
-
bioRxiv - Developmental Biology 2023Quote: Genotyping of ESCs and mouse tails were performed by PCR using KAPA Mouse Genotyping Kit (Roche, Cat. No. KK7302). Specific protocol followed the reagent instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 μg of the PCR product was used for RNA probe labeling with T7 RNA polymerase as per the DIG Northern Starter Kit’s Instruction Manual (Roche). Post-hybridization washes and immuno-chemiluminescent detection of the bound probe were conducted following the instructions provided in the DIG Northern Starter Kit manual (Roche) ...
-
bioRxiv - Plant Biology 2024Quote: We fragmented 700 ng of high-molecular-weight DNA using a Covaris S220 sonicator and a WGS library was generated for both species using the KAPA Hyper Prep kit with a PCR-free protocol according to the manufacturer’s instructions (Roche). We applied final size selection using a 0.7-fold ratio of AMPureXP beads ...
-
bioRxiv - Plant Biology 2024Quote: ... and the library was quantified by qPCR against a standard curve with the KAPA Library Quantification Kit (Kapa Biosystems). Libraries were sequenced on a NovaSeq6000 Illumina platform in 150PE mode ...
-
bioRxiv - Neuroscience 2024Quote: ... 30 μm sections were stained according to instruction of In situ Cell Death Detection Kit (Roche, Basel, Switzerland, #11684817910). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using a One-step BrightGreen RT-qPCR Kit (Abm, G471-S) following the manufacturer’s protocol in the LightCycler 96 Real-Time PCR System (Roche). Isocitrate dehydrogenase (ICDH ...
-
bioRxiv - Plant Biology 2024Quote: The labeling of probes with digoxigenin was performed using the 2nd generation DIG Gel Shift EMSA kit (Roche, USA), following the instructions provided by the manufacturer ...
-
bioRxiv - Immunology 2024Quote: ... adhering to the manufacturer’s recommendations for low-input DNA (MyBaits v5 kit Arbor Biosciences) and using KAPA Universal Enhancing Oligos ((Roche) to prevent non-specific binding ...
-
bioRxiv - Genomics 2024Quote: Total RNA and DNA:RNA hybrid samples were reverse transcribed into complementary DNA (cDNA) using Evoscript universal cDNA Master Kit (Roche, Germany ...
-
bioRxiv - Cancer Biology 2024Quote: ... On the following day 10 µl MTT labeling reagent (5 mg/ml) of the Cell Proliferation Kit I (Roche) was added and cells were incubated at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... The resulting polyA RNA was used as input into the KAPA RNA Hyper prep RNAseq library prep kit (Roche). Libraries were prepared with dual-index adapters ...
-
bioRxiv - Genomics 2024Quote: ... EM-seq and WGBS libraries were quantified using the KAPA library quantification kit (KK4854; Roche Molecular Systems, Pleasanton, CA) and pooled in equimolar amounts ...
-
bioRxiv - Immunology 2024Quote: ... Adapter ligation and indexing PCR was performed on these amplicons using KAPA HTP Library Preparation Kit (KK8234, Kapa biosystems) for multiplexing and sequencing on an Illumina HiSeq5 platform.
-
bioRxiv - Cancer Biology 2024Quote: ... The U6-sgRNA cassette was then amplified by PCR using the KAPA HIFI Hot Start PCR kit (Roche, KK2502) and different tagged primers required for the subsequent Illumina sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries for RNA-seq were prepared with KAPA Stranded mRNA-Seq poly(A) selected kit (KAPA Biosystems, Wilmington, MA) using 250 ng toal RNAs for each sample ...
-
bioRxiv - Physiology 2024Quote: ... 100 nanograms of total RNA were used for library preparation with the KAPA total RNA Hyperprep Kit (KK8581) (Roche). Each resulting uniquely dual-indexed library was quantified and quality accessed by Qubit and Agilent TapeStation ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 μg of total RNA was retro-transcribed using Transcriptor First Strand cDNA Synthesis Kit (Roche; Cat #04897030001) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Eluted mRNA was then reverse transcribed using random hexamer primers and Transcriptor First Strand cDNA Synthesis Kit (#04897030001, Roche) at 65°C for 10 min ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was isolated from A549 cells under different treatment conditions using the High Pure RNA Isolation Kit (Roche), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell death was evaluated separately using the Fluorescence In Situ Cell Death Detection kit (Roche Diagnostic, Indianapolis, IN, US). Brain sections were analyzed for DNA strand breakage using Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL ...
-
bioRxiv - Developmental Biology 2024Quote: ... Digoxigenin labeled antisense riboprobes were synthesized by in vitro transcription using a DIG RNA labeling kit (Roche, Cat#11277073910), followed by purification using Micro Bio-Spin P-30 gel columns (Bio-Rad ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 ng of amplified cDNA was used to prepare libraries with the KAPA Hyper Prep Kit (Kapa Biosystems, #KK8504) using 8 cycles of PCR ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were constructed from approximately 100 ng of genomic DNA using the Kappa HyperPrep Kit (Roche, Pleasanton, CA, USA) with mechanical shearing (Covaris ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA fragmentation was visualized by using an in situ cell death detection kit (Fluorescein; Cat #, 11684795910; Roche, Basel, Switzerland) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... The total RNAs were converted into individually barcoded polyadenylated RNAseq libraries with the Kapa HyperPrep mRNA kit (Roche, CA), with prior removal of rRNAs with the FastSelect Bacteria kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... pre-capture libraries were prepared from up to 100 ng of input DNA using the KAPA Hyperplus kit (Roche) and TruSeq adapters and barcoded primers (Illumina) ...
-
bioRxiv - Evolutionary Biology 2024Quote: A PCR free library was prepared following the Kapa Hyper Prep Kit procedure provided by Roche (Roche, Basel, Switzerland). The library was sequenced on a paired-end mode with an Illumina NovaSeq 6000 instrument (Illumina ...
-
bioRxiv - Plant Biology 2020Quote: ... The first-strand cDNA was synthesized from 2 μg of total RNA with an anchored-oligo (dT)18 primer using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... and the powder was solubilized in the native extraction buffer supplied in the kit with addition of Complete Protease Inhibitor Cocktail (Roche). After incubation on ice for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription was done with the first Strand synthesis kit (Fermentas) using oligo (dT)18 as a primer and qPCR was carried out with LightCycler 96 (Roche) using GAPDH.
-
bioRxiv - Cancer Biology 2021Quote: ... MCF-7 shRNA and MCF-7 shFTH1 as well as H460 shRNA and H460 shFTH1 using the High Pure RNA isolation kit (Roche) according to the manufacturer’ ss instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was used as the template to create the Scx mRNA probe by utilizing the DIG RNA Labeling Kit Catalog #11175025910 (Roche) and the T3 RNA polymerase Catalog #11031163001 (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... Target regions were amplified by using specific PCR primers (ETV2_F: CACTCGGGATCCGTTACTCC; ETV2_R: GTTCGGAGCAAACGGTGAGA, KDR_F: CAAGCCCTTTGTTGTACTCAATTCT; KDR_R: ATTAATTTTTCAGGGGACAGAGGGA) and KAPA HiFi HotStart PCR kit (KAPA Biosystems, Cat No. KK2601). Sanger sequencing (Genewiz ...
-
bioRxiv - Cell Biology 2020Quote: The RNA probes were transcribed with the T7 polymerase and labeled using the DIG RNA labeling kit (Roche Cat # 11175025910). After the labeling reaction was complete ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... were performed with the Ventana Bench-Mark XT automated staining system (Ventana) using the UltraView Universal DAB Detection Kit (Roche). For α-Syn ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA probes were created from in vitro transcription of PCR products carrying the T7 RNA polymerase recognition sequence at one end and synthesized by using a digoxigenin (Dig)-labeling kit (Roche). Wing discs of L3 larvae were hybridized with probes overnight at 56 °C using standard procedures and visualized using anti-Dig-AP (1:1,000 ...