Labshake search
Citations for Roche :
4051 - 4100 of 7151 citations for Human Protein Patched Homolog 2 PTCH2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... an equal volume of luciferase reagent (ATP Bioluminescence Assay Kit HS II, Roche) was added to each supernatant ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed and seeded at 2 x 106 cells/μm2 on glass bottom petri dish (Iwaki) coated with fibronectin (Roche, 1hour incubation, 25 μg/mL) or on fibronectin-micropatterned substrates ...
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Immunology 2021Quote: ... This lysate was incubated at 37 °C for 80 minutes and samples subsequently diluted in ice-cold DISC buffer (containing 2 mM NEM and Roche complete protease-inhibitor cocktail), cleared by centrifugation ...
-
bioRxiv - Genetics 2019Quote: ... The PCR reaction mixture in a 20 μl volume containing 10 μl of 2×SYBR Green PCR Master Mix (Roche, Mannheim, Germany, code#06402712001), 2 μl diluted reverse transcriptase product (1:100) ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Neuroscience 2019Quote: 88 μL of sample was subjected to RNase-free DNaseI treatment by the addition of 10 μL of 10X Buffer and 2 μL of RNase-free DNaseI (Roche 04 716 728 001) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.2 μM of both reverse and forward primers and the PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland). Each sample and primer pair was run in triplicates ...
-
bioRxiv - Genomics 2021Quote: ... then washed and resuspended in Wash buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine and Roche complete EDTA-free protease inhibitor), aliquoted with 10% DMSO and slow-frozen to −80°C in Mr ...
-
bioRxiv - Cell Biology 2020Quote: ... The buffers used in each step were supplemented with 1% (v/v) phosphatase inhibitor cocktail-2 and PhosSTOP (Roche: 1 tablet per 10 ml). Imaging of fixed samples was carried out on a Leica TCS SP8 MP microscope using oil immersion objective (HP CL APO CS2 63x/1.40 Oil) ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science, Mannheim, Germany) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2022Quote: ... The pellet was resuspended in 50 mL lysis buffer (20 mM Tris pH7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10% glycerol, protease inhibitor cocktail (Roche, as directed by manufacturer), 20 mM imidazole) ...
-
bioRxiv - Cell Biology 2022Quote: ... After three washes with PBS containing 0.5% Tween-20 samples were incubated with fluorescent labelled secondary antibodies containing 4′,6-diamidino-2-phenylindole (DAPI; Roche Cat# 10236276001, 1.0 µg/ml) for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... a final concentration of 1 ng/μl cDNA was mixed with 2 μl FastStart DNA Master SYBR Green I (Roche #03 003 230 001), 0.5 μM forward and reverse primer ...
-
bioRxiv - Biochemistry 2024Quote: ... 250 mg of powder was thawed at 4°C followed by resuspension in 1 mL of HIP buffer (40 mM HEPES-KOH pH 7.5, 110 mM KOAc, 2 mM MgCl2, 1% Triton X-100, 0.1% Tween, 1x protease inhibitor cocktail [Roche], 1% solution P, 1 mM DTT). The lysate was next passed through a Whatman 25 mm GD/X Disposable filter (Cat No ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 mM NaCl, 0.1 mM EDTA, 10% [v/v] glycerol, 1% [w/v] digitonin, 2 mM PMSF, 1 x Roche EDTA free protease inhibitor cocktail). After removing the debris by a clarifying spin (12,000 x g ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cancer Biology 2023Quote: ... Fractions were supplemented with SDS (to a final concentration of 1%) and then digested with proteinase K (Roche, final concentration of 2 µg/ml) for 45 min at 42 C ...
-
bioRxiv - Biochemistry 2023Quote: ... and were resuspended in 30 mL lysis buffer 1 (50 mM sodium phosphate, 300 mM NaCl, pH 8) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension three times through a Constant Cell disruption system (TS benchtop ...
-
bioRxiv - Physiology 2024Quote: ... and homogenised with 650-800 mg silica beads for 2× 30 second homogenisation steps at 6500 rpm (MagNA lyser, Roche Diagnostics, North Ryde, Australia). RNA was extracted from the homogenised lysate using an Allprep DNA/RNA/miRNA Universal extraction kit (#80224 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Tissues were solubilized in lysis buffer (125 mM Tris-HCl pH 6.8, 2% SDS, 0.01% β-mercaptoethanol, cOmplete Mini EDTA-free (Roche, cat. 04 693 159 001)) ...
-
bioRxiv - Genetics 2024Quote: ... 30 mM Tris-HCl, 20 mM KCl, 2 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 150 mM NaCl, cOmplete proteinase inhibitor [Roche Diagnostics, Indianapolis, IN, USA]), lysed by ultrasonic treatment and incubated with EZview anti-HA agarose beads (Sigma-Aldrich ...
-
bioRxiv - Physiology 2021Quote: ... PCR products were cleaned up using the High Pure PCR Product Purification Kit (Roche) and sequenced by LGC Genomics GmbH ...
-
bioRxiv - Microbiology 2020Quote: ... the super pools were quantified using the Kapa qPCR Illumina quantification kit (Kapa Biosystems) prior to sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Postamplification libraries were size selected at 250–450 bp in length using Agencourt AMPure XP beads from Beckman Coulter and were quantified using the Library Quantification Kit from Illiumina (Kapa Biosystems, KK4603). Libraries were pooled to a final concentration of 10nM and sequenced single-end using the Illumina HiSeq 4000.
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were generated using the Kapa RNA HyperPrep kit with RiboErase (HMR, Kapa Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tail genomic DNA was extracted using a KAPA mouse genotyping Kit (KAPA Biosystems KK7352), and PCR was performed using primers as described in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the Kapa Illumina GA with Revised Primers-SYBR Fast Universal kit (Kapa Biosystems). Average size fragment was determined using a LabChip GX (PerkinElmer ...
-
bioRxiv - Cell Biology 2020Quote: ... and apoeb transcripts were generated using the DIG RNA Labeling Kit (Roche Applied Science) from linearized plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... The rDNA and telomere probes were labeled by nick translation kit (Roche, Basel, Switzerland). The chromosome 3 painting probe was labeled with ATTO-550 as previously described (Albert et al. ...
-
Optimized immunoglobulin knock-ins using Cas9 reveal peritoneal B cell lineage relationships in vivobioRxiv - Immunology 2021Quote: ... Custom DIG-labeled probes were generated using PCR DIG Probe Synthesis Kit (Roche #11636090910) and blots were hybridized for 16 hours at 48°C with a final concentration of 25ng/ml probe in 10ml DIG EasyHyb buffer rolling in hybridization tubes ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid DNA was extracted from recombinant clones with the High Pure Isolation kit (Roche) as directed by the manufacturer and sequenced in an ABI PRISM 3100 genetic analyzer (Applied Biosystem ...
-
bioRxiv - Genetics 2021Quote: We generated RNA-seq libraries using the KAPA Stranded mRNA-seq kit (KAPA Biosystems) from 500 ng RNA for each library and did 150 bp pair-end sequencing ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cDNA synthesis was performed with the cDNA synthesis kit (Roche Product No: 11483188001). ΔCt values were measured using the “Multiple Plate Analysis” program ...
-
bioRxiv - Genomics 2020Quote: ... MeDIP library DNA concentrations were estimated using the Kapa Library Quantification kit (Kapa Biosystems) and were further verified by running on an Agilent High Sensitivity DNA chip on an Agilent 2100 BioAnalyzer ...
-
bioRxiv - Genomics 2020Quote: ... The generated paired-end libraries were quantified by qPCR (KAPA Library Quantification Kit, Roche) and then sequenced at the Federal University of Rio Grande do Sul ...
-
bioRxiv - Genomics 2021Quote: ... Quantification was performed in a qPCR with Kapa Library quantification kit (Roche, Basel, Switzerland). The first batch of library specimens were sequenced with HiSeq 4000 system ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified DNA fragments were prepared with the KAPA HTP Library Preparation kit (Roche) and single-end sequenced with a 65-cycle kit on an Illumina HiSeq 2500.
-
bioRxiv - Developmental Biology 2021Quote: ... 1ug of RNA was retrotranscribed using Transcriptor First Strand cDNA Synthesis Kit (Roche 04897030001) and Real-time quantification was performed using SYBR Green Master Mix (Roche 04887352001) ...
-
bioRxiv - Developmental Biology 2020Quote: Tissue ATP level was measured using the ATP Bioluminescence Assay Kit HS II (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each PCR product was ligated into Eam1105I-digested pJC53.2 vector (Quick Ligation Kit, Roche) for use in ISH and RNAi experiments (Collins et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... incorporating digoxigenin (DIG)-UTP via a DIG-labelling kit (Roche, Mannheim, Germany Cat#11277073910).
-
bioRxiv - Developmental Biology 2021Quote: ... Library concentration was determined with KAPA Library Quantification Kit for Illumina Platforms (Kapa Biosystems). Sequencing was performed on the Illumina NextSeq550 (75bp pair-end reads).
-
bioRxiv - Developmental Biology 2020Quote: ... Single stranded riboprobes were transcribed with a Roche DIG Labeling Kit (Roche, Basel, Switzerland) incorporating a digoxigenenin (DIG)-conjugated uracil every 20 to 25 nucleotides ...
-
bioRxiv - Molecular Biology 2020Quote: ... and libraries were quantified by Q-PCR using the Kapa Library Quantification Kit (Roche). RNA-seq experiments were performed on an Illumina HiSeq3000 using a paired-end read length of 2×150 pb.
-
bioRxiv - Molecular Biology 2021Quote: ... QHR-4C libraries were purified by the High-Pure PCR Product Purification kit (Roche).
-
bioRxiv - Neuroscience 2021Quote: ... Quantity was assessed with an Illumina Universal Adaptor-specific qPCR kit from KAPA Biosystems (KAPA Library Quantification Kit for Illumina NGS ...
-
bioRxiv - Neuroscience 2021Quote: ... as well as the KAPA Dual-Indexed Adapter Kit from Roche (Cat. No. 8278555702). Upon completion of library construction ...