Labshake search
Citations for Roche :
3951 - 4000 of 9543 citations for Mouse DTW Domain Containing Protein 2 DTWD2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... The spheroplasts were resuspended in ice-cold D-buffer (0.6 M sorbitol, 10 mM Tris-HCl pH 7.4) containing protease inhibitors (complete protease inhibitor cocktail, Roche; 1 tablet per 50 mL), and lysed by 10 strokes in a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2022Quote: ... They were scooped with a brush and dropped in a glass tube containing the homogenization buffer (HB; 0.32 M sucrose and one tablet Complete mini EDTA-free protease inhibitor cocktail (Roche; 10 ml, pH 7.4)) at 4°C (50 μl of buffer for each slice) ...
-
bioRxiv - Genomics 2019Quote: Donor organs were obtained with written consent and research ethics approval at the University of Alberta (Pro00013094, Pro00001754), perfused via the pancreatic ductal system with buffer containing Collagenase Gold 800 (VitaCyte, Indianapolis, IN) and Thermolysin (Roche Diagnostics, Mannheim, Germany), then digested with a Ricordi Islet Isolator (Biorep Diabetes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CaCo-2 and Vero cells seeded at a density of 5 × 103 cells and 7 x 103 per well in 200 μl media containing 10% FBS in a 16-well E-plate (Roche Applied Science, Germany), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... tissues or cells were homogenized in a RIPA buffer containing cOmplete Protease Inhibitor Cocktail and PhosphoSTOP Phosphate Inhibitor Cocktail Tablets (Roche, Indianapolis, IN, USA) using a Bead Ruptor 24 Elite bead mill homogenizer (Omni International ...
-
bioRxiv - Microbiology 2020Quote: ... the pelleted cells were re-suspended in 10 mM Tris pH 7.6 buffer containing cOmplete EDTA-free protease inhibitor cocktail (Roche Applied Sciences, Penzberg, Germany), sonicated ...
-
bioRxiv - Cancer Biology 2022Quote: ... frozen human samples were disrupted in 600 µl of lysis buffer containing green ceramic beads using the MagNA Lyser Instrument (Roche Life Science, Germany). The cDNA synthesis was performed in a 20-µl reaction using random hexamers ...
-
bioRxiv - Neuroscience 2022Quote: ... The supernatant was aspirated and the pellet was resuspended in a pre-warmed digestion mix containing 1 mg ml-1collagenase/dispase (Roche Diagnostics, Indianapolis, USA) and 10 μg ml-1DNase I (Roche Diagnostics ...
-
bioRxiv - Genomics 2024Quote: ... the tissue fragments were transferred into a Douncer homogenizer containing a protease inhibitor cocktail (PIC, Roche, 1 tablet in 50 ml of PBS) solution immersed in ice and homogenized using pestles A and B (from less to more plunger adjustment) ...
-
bioRxiv - Biophysics 2023Quote: ... The 500-bp dsDNA handle was the PCR product of a segment of pBluescript II KS using primers containing BfuAI and BSaI recognition sequences (forward primer: GCTGGGTCTCGTGGTTTCCCTTTAGTGAGGGTTAATTG; reverse primer: TATAGTCCTGTCGGGTTTCG) in the presence of Digoxigenin-11-dUTP (Roche; dTTP/dUTP = 4.5). The Digoxigenin-modified 500-bp handle DNA was digested to create the complementary overhang ...
-
bioRxiv - Immunology 2023Quote: ... a left lobe was digested for 1 hour at 37°C in RPMI containing 13 mg/mL DNase I (Roche, Randburg, South Africa) and 50 U/mL collagenase IV (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... and the cell pellet was re-suspended in 2 ml of triturating solution (containing 10 mg/ml bovine serum albumin [A7906, Sigma], 0.5 mg/ml trypsin inhibitor [10109886001, Roche], 0.02 mg/ml deoxyribonuclease).
-
bioRxiv - Cell Biology 2020Quote: ... Japan) was employed for detection of proteins visualized by Lumi-light Plus Western blotting substrate (Roche, Basel, Switzerland).
-
bioRxiv - Cell Biology 2019Quote: ... Japan) was employed for detection of proteins visualized by Lumi-light Plus Western blotting substrate (Roche, Basel, Switzerland).
-
bioRxiv - Immunology 2019Quote: ... The protein was produced by transient transfection of HEK 293T cells with XtremeGene™ HP Transfection reagent (Roche) according to the manufacturer’s instructions and purified following a published protocol (77) ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were transferred to PVDF membranes and labelled overnight with anti-HA (0.01 μg/mL, Roche clone 3F10), anti-VE-Cadherin (0.5 μg.ml−1 ...
-
bioRxiv - Biochemistry 2019Quote: Overall protein was extracted through RIPA lysis buffer (Beyotime Biotechnology, Shanghai, China) with protease inhibitors (Roche, Basel, Switzerland), and then quantified through BCA™ Protein Assay Kit (Pierce ...
-
Individual differences in honey bee behavior enabled by plasticity in brain gene regulatory networksbioRxiv - Genomics 2020Quote: ... with protein inhibitor complex (PIC, Complete Tablets, EDTA-free Protease Inhibitor Cocktail from Roche, Basel, Switzerland, cat. #04693132001) using a motorized pestle for 20 seconds ...
-
bioRxiv - Microbiology 2021Quote: ... Equivalent amounts of protein samples were separated by SDS-PAGE and electroblotted onto a polyvinylidene fluoride membrane (Roche) using a Mini Trans-Blot Cell (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... shTDP-43 HEK293E cell pellets from confluent 10cm plates were washed twice in ice-cold PBS and then resuspended in 500μl of hypotonic buffer A (10mM HEPES, 1.5mM MgCl2, 10mM KCl, 0.1mM DTT and protein inhibitor cocktail (Roche) and incubated on ice for 5 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... The total protein pellets were resuspended in 1 mL NP-40 with protease inhibitor cocktail (Roche Diagnostics GmbH). Samples were pre-cleared using Protein A/G plus agarose beads (Pierce ...
-
bioRxiv - Plant Biology 2019Quote: ... The presence of the proteins of interest was tested by immunodetection using rat anti-HA-peroxidase (3F10, Roche) or chicken anti-c-Myc primary antibody (A2128 ...
-
bioRxiv - Cancer Biology 2019Quote: All A673/TR/shEF in vitro and xenograft proteins were extracted with RIPA and anti-protease cocktail (Roche). Western blots were hybridized with rabbit monoclonal anti-FLI1 antibody (1:1000 ...
-
bioRxiv - Immunology 2020Quote: ... The TM protein was produced by transient transfection of HEK 293T cells with XtremeGene HP Transfection reagent (Roche) according to the manufacturer’s instructions and purified following a published protocol (48) ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was purified from filtered cell supernatants using StrepTactin resin (IBA) or cOmplete His-Tag Purification Resin (Roche) or Jacalin (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2021Quote: After being pre-cleared with protein A/G-coupled Sepharose beads (Cat. 11134515001 and 11243233001, Roche, Mannheim, Germany) for 2 hrs ...
-
bioRxiv - Microbiology 2021Quote: ... Separated proteins were transferred to PVDF membranes (GE Water & Process Technologies) and treated with Western blocking reagent (Roche) for overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... The protein was produced by transient transfection of HEK 293T cells with X-tremeGENE HP Transfection Reagent (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: Protein extraction was performed using RIPA buffer in the presence of complete Mini EDTA-free protease inhibitor (Roche) and PhosSTOPTM phosphatase inhibitor (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal quantities of protein were electrophoresed on 10% SDS-PAGE and transferred onto a nitrocellulose membrane (Roche Diagnostics). The membranes were incubated with the primary antibody overnight at 4°C after blocking with 5% milk dissolved in TBST buffer for another 2 h at room temperature (25°C) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the frozen brain samples were homogenized in tissue protein extraction reagent (Pierce) supplemented with complete protease inhibitors (Roche), and centrifuged for 1 hour at 430 000 g at 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The enriched FLC-Venus protein was detected by western blot assay with the antibody anti-GFP (11814460001, Roche). Signals were visualized with chemiluminescence (34095 ...
-
bioRxiv - Pathology 2024Quote: Cholesterol and triglyceride levels were quantified in liver protein lysates and EDTA-plasma using enzymatic colorimetric assays (c.f.a.s. cobas, Roche Diagnostics) according to the manufacturer’s protocol ...
-
Reduction of Spermine Synthase Suppresses Tau Accumulation Through Autophagy Modulation in TauopathybioRxiv - Neuroscience 2023Quote: For immunoblot analysis of proteins, tissues were homogenized in RIPA buffer (R0278, Thermo) with proteinase inhibitors (11836170001, Roche) and phosphatase inhibitors (04906837001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Two days after transfection cells were washed twice with ice-cold PBS and scraped in ice-cold Co-IP buffer (10 mM Tris/Cl pH 7.5, 150 mM NaCl, 0.5 mM EDTA, protein inhibitor cocktail (Roche)) supplemented with 0.5% Nonident P40 ...
-
bioRxiv - Neuroscience 2023Quote: ... Supernatants were pre-cleared by incubating with 30 μl of protein G-agarose beads suspension (Roche, cat. # 11719416001) for 3 h at 4°C on a mini-rotator ...
-
bioRxiv - Cancer Biology 2023Quote: ... The His-tagged-TRF2TRFH protein was purified in presence of cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche) by using Protino ® Ni-TED 2000 Packed Columns (Macherey-Nagel ...
-
bioRxiv - Cancer Biology 2024Quote: ... protein samples were subjected to 10% SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes (Roche, Mannheim, Germany). Afterwards ...
-
bioRxiv - Cell Biology 2024Quote: Cell protein was extracted on ice in cold whole-cell RIPA buffer supplemented with protease inhibitor cocktail (Roche). SDS-PAGE was performed using 10% Tris-glycine gels ...
-
bioRxiv - Biochemistry 2024Quote: ... HA- and GFP-tagged proteins were detected using horseradish peroxidase-conjugated monoclonal anti-HA (Roche, 3F10, 1:5,000) and anti-GFP (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: Cell lines: Cells were lysed with RIPA buffer and prepared for total protein extraction with protease inhibitors (Roche). After 20 minutes of centrifugation (>16000g) ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM PMSF and 1 tablet/80 ml of complete EDTA-free protease inhibitor cocktail (Roche)] ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed in ice-cold FACS buffer (2% FBS, (0.5 ug/ml) DNase I (Roche), 2 mM EDTA in PBS) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Library amplification and indexing were performed with KAPA HiFi HotStart Uracil+ ReadyMix (2×) (Kapa Biosystems KK2801). The PCR amplification was carried out as follows ...
-
bioRxiv - Genomics 2019Quote: ... The remaining fragments were then treated with a collagenase/dispase mixture (2 mg/mL final) (Roche) and DNase I (2 mg/mL final ...
-
bioRxiv - Genomics 2020Quote: ... contaminating genomic DNA was removed by incubating with 2 µl of RNase-free DNase I (Roche) for 30 min at 37 °C ...
-
bioRxiv - Immunology 2019Quote: ... with both basic (Cell Conditioner 1) and mildly acidic (Cell Conditioner 2) antigen retrieval methods (Roche, Ventana Medical Systems ...
-
bioRxiv - Biophysics 2019Quote: ... (5) motor solution consisting of 2 μM biotinylated KIF1A in motor dilution buffer (1mM ATP [Roche] ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of sample was mixed with 10 µL 2X SYBR Mix (Kapa Biosystems, Wilmington, MA), 0.4 µL of each 10 µM primer (IDT ...
-
bioRxiv - Microbiology 2021Quote: ... spanning the SARS-CoV-2 genome) were purified using Kapa HyperPure beads (Roche Molecular Systems Inc) and quantified using a Qubit fluorometer and dsDNA HS Assay Kit (Thermo Fisher Inc ...