Labshake search
Citations for Roche :
351 - 400 of 843 citations for Recombinant Human APOM Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: Human stem cells and neurons lysed with RIPA lysis buffer supplemented with 5mM EDTA and protease inhibitor (Roche), for 5 minutes at room temperature and 10 minutes on ice ...
-
bioRxiv - Immunology 2021Quote: ... freshly resected human samples were cut into small fragments and digested with 0.1 mg/ml Liberase TL (Roche) and 0.1 mg/ml DNase (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: On day 0 (start of differentiation) human pluripotent stem cells were treated with 1mg/ml Collagenase B (Roche) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... human vimentin immunohistochemical staining of the paraffin sections was performed by using the Ventana Discovery XT instrument (Roche) with Ventana DAB Map detection Kit (760-124 ...
-
bioRxiv - Cell Biology 2019Quote: ... protein was isolated from hMPCs with RIPA buffer containing phosphatase (PhosSTOP, Roche) and protease (cOmplete ...
-
bioRxiv - Cell Biology 2020Quote: ... and protein was eluted by cleaving with 20 U/ml thrombin (Roche) in TCB (50 mM Tris ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... resuspended in protein resuspension buffer (2% SDS, 10 mM NaF, 1x Roche cOmplete Mini proteinase inhibitor cocktail ...
-
bioRxiv - Molecular Biology 2020Quote: ... Soluble protein was purified using batch/gravity-flow affinity chromatography (cOmplete, Roche). MED1 (50-660 ...
-
bioRxiv - Developmental Biology 2020Quote: ... GFP and FLAG tagged proteins were visualized by mouse anti-GFP (Roche) and anti-FLAG M2 antibodies (Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... Protein was detected by incubation with a solution of NBT/BCIP (Roche) as per the manufacturer’s protocol.
-
bioRxiv - Microbiology 2019Quote: ... and pre-cleared with 80 μl of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Cell Biology 2019Quote: ... Secondary antibodies used for immunoprecipitation were Protein G Agarose beads (Roche, 1124323301) and anti-FLAG (M2 ...
-
bioRxiv - Genomics 2021Quote: ... proteins were visualized using the lumi-light plus western blotting substrate (Roche).
-
bioRxiv - Plant Biology 2020Quote: ... Proteins were immunologically detected by using anti-HA (3F10)-HRP (Roche, Switzerland) or anti-Myc-tag (HRP-DirecT ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged proteins were detected with Anti-c-myc-Peroxidase (Roche #11814150001) at dilution of 1:5,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... the proteins were transferred onto a PVDF membrane (Roche Diagnostics, Mannheim, Germany). Cofilin1 and phospho-Cofilin1 (Ser3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... HA-tagged proteins were detected using 1:1,000 anti-HA antibody (Roche) and 1:5,000 anti-rat antibody (Abcam) ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were lysed and sonicated in RIPA buffer with protein inhibitors (Roche). Protein concentrations were estimated by BCA assay (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... and subsequently proteins were digested by addition of proteinase K (Roche #03115852001) at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The relipidated proteins were treated with 1 mM AMPPNP (sodium salt, Roche) for overnight at 4 °C and desalted with a PD-10 column ...
-
bioRxiv - Plant Biology 2022Quote: ... and proteins were eluted by using 0.25 mg/ml HA peptide (Roche). HA- and FLAG-tagged proteins were immunologically detected using HRP-conjugated anti-HA 3F10 (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... Immune complexes were captured using 20 µl Protein A agarose beads (Roche, previously saturated with 1 mg/ml BSA and 1mg/ml yeast tRNA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and total serum protein (TSP) were determined using kits supplied by Roche Diagnostics and the Roche/Hitachi Analyzer machine at Al-Aulaqi Specialized Medical Laboratory ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged proteins were detected using anti-myc antibody (mouse monoclonal; Roche) di-luted 1:5000 (v/v) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were detected using monoclonal anti‐GFP (mouse; 1:3000; Roche 11814460001). Secondary antibody was HRP‐linked anti‐mouse polyclonal (goat ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were extracted using EB2 supplemented with 1X PhosSTOP (Roche, Indianapolis, IN) and FLAG immunoprecipitation was performed using anti-FLAG M2 agarose (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA-protein complexes were immunoprecipitated using a monoclonal anti-GFP antibody (Roche). Analysis of enrichment of target genes was performed by qPCR using the oligos listed in the Table S2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and proteins were digested with 0.04 mg/mL proteinase K (Roche #03115852001). DNA was recovered using a DNA purification kit (Bioline #52060) ...
-
bioRxiv - Neuroscience 2022Quote: ... protein G-Sepharose Fast Flow and immobilized streptavidin Mutein Matrix from Roche; protein molecular weight standards from Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... proteins were extracted using RIPA (Triton 1%) buffer supplemented with protease (Roche) and phosphatase inhibitors (Roche).
-
bioRxiv - Plant Biology 2022Quote: ... After last wash proteins were cleaved by adding sequencing grade trypsin (Roche) in a 1:100 trypsin:protein ratio ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein pellets were suspended in in cOmplete Protease Inhibitor Cocktail (Roche) containing radio-immunoprecipitation assay (RIPA ...
-
bioRxiv - Microbiology 2023Quote: ... and pre-cleared with 80 μl of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... Fusion proteins were detected with α-Myc monoclonal antibodies (Roche, Stockholm, Sweden). The following constructs were used ...
-
bioRxiv - Microbiology 2023Quote: ... and pre-cleared with 80 μl of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Microbiology 2023Quote: ... and pre-cleared with 80 μL of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Developmental Biology 2023Quote: ... and subsequently incubated with 20 μL of protein G-agarose beads (Roche) or protein A-agarose beads (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were then degraded by addition of 50 µg Proteinase K (Roche) and incubation at 56°C for 90 minutes ...
-
bioRxiv - Cell Biology 2023Quote: The TetR-eYFP tagged proteins were transfected using the XtremeGene-9 (Roche) transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: We purchased the following purified ECM proteins: fibronectin from Roche (Cat# 11051407001), laminin from Sigma‒Aldrich (Cat# L6274) ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by affinity isolation with Protein A agarose beads (Roche, PROTAA-RO) overnight at 4°C on an end-over-end rotator ...
-
bioRxiv - Genetics 2024Quote: Protein extracts were prepared in RIPA buffer containing protease (Complete Mini, Roche) and phosphatase (PhosSTOP ...
-
bioRxiv - Developmental Biology 2024Quote: ... AFSC-EV protein was extracted via a phosphatase and protease inhibitor (Roche) containing tissue extraction buffer (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...