Labshake search
Citations for Roche :
351 - 400 of 6336 citations for Progesterone ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: Isolated B cells from Gal9KO mice were lysed in NP40 lysis buffer (50 mM HEPES pH 8.0, 150 mM NaCl, 5 mM dithiothreitol, 5 mM EDTA, 0.1% Nonidet-P40, Roche cOmplete mini EDTA-free protease inhibitor ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM NaF and protease inhibitors (Roche)] ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 5 μL/mL NBT (Roche, 11383213001), was then added and slides were placed at 37°C to allow colour to develop ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% glycerol and protease inhibitor cocktail (Roche). The cell debris was removed from the lysate by centrifugation at 16,000 rpm for 30min ...
-
bioRxiv - Neuroscience 2020Quote: ... midazolam (5 mg/kg bodyweight; Dormicum, Roche), and medetomidine (0.5 mg/kg bodyweight ...
-
bioRxiv - Cell Biology 2021Quote: ... in 5 mg ml−1 dispase (Roche) and 0.1 mg ml−1 DNase I (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... and 5 μg of RNase A (Roche) per mg of cross-linked complex and incubated at 52 °C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 μl of SybrGreen master mix (Roche) and 1 μl of water were processed in a LightCycler® 480 instrument (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% glycerol and 1x protease inhibitor (Roche)] ...
-
bioRxiv - Genetics 2024Quote: ... 5 μg/ml DNAse I (Roche 10104159001), and 0.05%Trypsin (Gibco 25200056 ...
-
bioRxiv - Cell Biology 2024Quote: ... and blocked in 5% BSA (Roche, 10735086001) in PBS solution ...
-
bioRxiv - Immunology 2020Quote: Gene expression levels were determined by triplicate using 113 ng of the cDNA and the pair of oligos for each gene in plates 96 optical Wells LightCycler 480Multiwell plates 96/384 Clear (Roche Applied Science, Mannheim, Germany), using 18s and Cyclophilin as constituent controls ...
-
bioRxiv - Developmental Biology 2021Quote: ... The plates were then coated with laminin solution (Roche, 11243217001) for 2 hours at 37°C and kept ready for use ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5000 cells were seeded in a 96 E-plates (Roche) and the electrical impedance was acquired every 15 minutes for seven days to establish a cell index value extracted from the linear regression of the proliferation curve ...
-
bioRxiv - Biochemistry 2020Quote: ... using a 384-well plate with an optical film (Roche).
-
bioRxiv - Molecular Biology 2021Quote: ... plates were washed and incubated with streptavidin-HRP conjugate (Roche) for 30 mins ...
-
bioRxiv - Neuroscience 2021Quote: ... Plates were sealed by LightCycler® 480 Seal Foil (Roche Life Science ...
-
bioRxiv - Physiology 2021Quote: ... instrument using LightCycler 384-well plates with sealing foil (Roche). The reaction volume of 10 μl contained ...
-
bioRxiv - Plant Biology 2021Quote: ... in 384-wells plates on a Lightcycler LC480 apparatus (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... mEpiSCs passaged off MEF-coated plates onto fibronectin (Roche 11051407001) coated plates for a single passage using StemPro™ Accutase™ to avoid MEF contamination ...
-
bioRxiv - Cell Biology 2021Quote: ... in a 96-well white plate (Roche, cat. no. 4729692001) using a LightCycler480 (Roche ...
-
bioRxiv - Cell Biology 2022Quote: RNA was extracted from culture plates using Tri Reagent (Roche) and isolated using Direct-Zol RNA miniprep kits (Zymo Research) ...
-
bioRxiv - Immunology 2023Quote: ... the plate was incubated with Streptavidin-POD conjugate (Roche, 11089153001) for 1h at RT ...
-
bioRxiv - Physiology 2024Quote: ... instrument using LightCycler 384-well plates with sealing foil (Roche). The reaction volume of 10 μl contained FastStart Essential DNA Green Master Mix (2X ...
-
bioRxiv - Cancer Biology 2019Quote: ... the cell pellets were resuspended in lysis buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 % NP-40, 5 mM MgCl2, 5 % glycerol and protease inhibitor cocktail [Roche]) and incubated for 20 min at 4 °C with end-over-end rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Triton X-100, 1 mM PMSF, 1x protease inhibitor cocktail [Roche] ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche cOmplete EDTA-free protease inhibitor catalog # 11872580001) ...
-
bioRxiv - Microbiology 2019Quote: ... pH 7.4, 150 mM NaCl, 5 mM EDTA, 5% glycerol, 1% Triton X-100, and 1x complete protease inhibitor [Roche]). Cleared lysates were then incubated with glutathione sepharose (GE healthcare ...
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analysed on a LC480 instrument (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analyzed on a LC480 instrument (Roche).
-
bioRxiv - Genetics 2021Quote: ... and the cell pellet resuspended in cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton X-100, cOmplete protease inhibitor cocktail, Roche) and incubated on ice for 30 minutes ...
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol, 50mM KCl, 5 mM EDTA, 0.1% Triton X-100, 5 mM DTT and 1 × protease inhibitor cocktail [Roche]). The homogenized lysates were incubated at 4 °C for 1 hour for western blot analysis of eIFiso4G1 or overnight for mass spectrometry analyses with 50 µl of prewashed immobilized γ-aminophenyl-m7GTP (C10-spacer)-agarose beads (Jena Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... blocked in 5 % milk and probed with α-GFP (1:1,000 in 5 % milk; Roche Diagnostics GmbH, Mannheim, Germany), for GFP-based sensor probing ...
-
bioRxiv - Biochemistry 2023Quote: ... after removal of the medium cells were lysed in 1 mL of lysis buffer (50 mM Hepes [pH 8.0], 150 mM NaCl, 1 mM DTT, 5 mM MgCl2, 5 % Glycerol, supplemented with 0.55 % Nonidet P40 substitute [Roche] and cOmpleteTM EDTA-free Protease Inhibitor Cocktail [Roche]) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Systems Biology 2019Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM b-glycerophosphate, 5 mM NaF, 1 mM Na3VO4 and protease inhibitors (Roche cOmplete ULTRA Tablets ...
-
bioRxiv - Neuroscience 2019Quote: ... Striatum and ventral midbrain from injected and non-injected hemispheres were rapidly dissected and homogenized with 6 volumes of Triton lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton-X100, 1 mM EDTA, 1X EDTA-free Complete protease inhibitor cocktail [Roche] and 1X phosphatase inhibitor cocktail 2 and 3 [Sigma]) ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 1□mM EDTA, 1X Complete Mini protease inhibitor cocktail [Roche]). Tissues were disrupted using a mechanical homogenizer (IKA T10 basic ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mM KCl, 10mM MgCl2, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF, 1 mM TCEP, cOmplete Protease Inhibitor Cocktail, Roche) in 2 steps ...