Labshake search
Citations for Roche :
351 - 400 of 4733 citations for PCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... using LightCycler® 480 probes master mix (4887301001, Roche) and Taqman probes (Life Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... a SYBR green-containing master mix (Roche, Basel, Switzerland) was used ...
-
bioRxiv - Plant Biology 2020Quote: ... FastStart SYBR Green Master Mix (Roche, Grenzacherstrasse, Basel, Switzerland) reagent was used in combination with primers (Table S3 ...
-
bioRxiv - Plant Biology 2021Quote: ... using Kapa Sybr Fast qPCR Master Mix (Kapa Biosystems) and specific primers for CYCB2;1 (Solyc02g082820) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems). Primers are described below:
-
bioRxiv - Cancer Biology 2020Quote: ... with FastStart SYBR Green Master Mix (Roche Applied Science) for quantitative real-time RT-PCR (40) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and LightCycler480® SYBR Green I Master mix (Roche). The 10 uL reactions were performed in triplicate ...
-
bioRxiv - Neuroscience 2019Quote: ... The LightCycler 480 SYBR Green I master mix (Roche) was used for real-time PCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the Applied Biosystems SYBR Green Master Mix (Roche) on a 384-well plate ...
-
bioRxiv - Physiology 2020Quote: ... SYBR Green Master Mix Reagent was purchased from Roche, Switzerland ...
-
bioRxiv - Plant Biology 2020Quote: ... with KAPA SYBR FAST qPCR master mix (Kapa Biosystems). The qPCR conditions were as follows ...
-
bioRxiv - Developmental Biology 2019Quote: ... with FastStart Universal SYBR Green Master mix (04913914001, Roche) according to conditions specified by the manufacturer ...
-
bioRxiv - Genetics 2020Quote: ... containing 6.25 μl 2X EagleTaq Universal Master Mix (Roche), 1μl of sample cDNA and 0.63μl of Probe+Primers mix (TaqMan Gene Expression Assays ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 µL FastStart Essential DNA Green Master Mix (Roche) and 10 µM primers in a final volume of 10
-
bioRxiv - Cancer Biology 2020Quote: ... using SYBR Green I master mix (Roche, Cat. #04887352001). The primer sets used for all the real time PCR assays are listed on the Table S7.
-
bioRxiv - Microbiology 2021Quote: ... with FastStart Essential DNA Green master mix (Roche, 06402712001), and 0.5μM of each primer ...
-
bioRxiv - Immunology 2020Quote: ... A SYBR Green I Master Mix kit (Roche, 04887352001) was used for real-time PCR with a LightCycler® 480 system (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... using Fast Start Universal SYBR Green Master Mix (Roche). Primer sequences are listed in Table S1 ...
-
bioRxiv - Cell Biology 2022Quote: ... using FastStart Universal SYBR Green Master mix (Roche, #4913850001). All protocols were performed according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... The FastStart Universal SYBR Green Master mix (ROX; Roche) was used on a QuantStudio 5 Real-Time polymerase chain reaction (PCR ...
-
bioRxiv - Microbiology 2023Quote: ... with FastStart SYBR Green Master mix (Roche, Cat. 04673492001). Primers for qPCR are listed in Supplementary Table 4.
-
bioRxiv - Cell Biology 2023Quote: ... and LightCycler 480 SYBR Green I Master Mix (Roche) using the following parameters ...
-
bioRxiv - Cell Biology 2022Quote: ... using the FastStart universal SYBR Green master mix (Roche). The sample volume of 12.5 μl contained 1x SYBR Green master mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the LightCycler 480 SYBR green master mix (Roche). The qRT-PCR primers used in this study are listed in supplementary table ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Fast Start Universal SYBR Green Master Mix (Roche) with the following primers ...
-
bioRxiv - Plant Biology 2023Quote: ... using Light-Cycler480 SYBR Green I Master Mix (Roche). Relative transcript levels were calculated using the 2−ΔCT method relative to wheat Ta27922 (Wu et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... FastStart Universal SYBR Green Master Mix (ROX) from Roche was used together with GFP-qPCR F/R primers ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μl of SYBR Green Select Master Mix (Roche), and ...
-
bioRxiv - Neuroscience 2023Quote: ... using 2x SYBR GREEN Master Mix (Roche Diagnostic, Switzerland) as reagent ...
-
A gene desert required for regulatory control of pleiotropic Shox2 expression and embryonic survivalbioRxiv - Developmental Biology 2023Quote: ... using KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems) for GDΔ samples ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μl of KAPA HiFi 2X master mix (Roche) and 3 μl of diluted overnight culture grown in 96-well plates ...
-
bioRxiv - Immunology 2024Quote: ... this contained 1× KAPA HiFi master mix (Roche, #KK2601), 0.5 μM Smart-seq3 forward primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time qPCR with SYBR Green Master Mix (Roche) was performed to evaluate AAV9 titers.
-
bioRxiv - Plant Biology 2024Quote: ... and using the SYBR Green I Master mix (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... (4) we used KAPA HiFi master mix (Roche, 07958935001) and 19 cycles of PCR.
-
bioRxiv - Cancer Biology 2024Quote: ... using 25ul of KAPA High Fidelity master mix (Roche). The following PCR program was used ...
-
bioRxiv - Cell Biology 2024Quote: ... Faststart Essential DNA Green Master mix (Roche, Basel, Switzerland) was used to perform qPCR on a Lightcycler 96 Real-Time PCR System (Roche ...
-
bioRxiv - Genomics 2021Quote: ... 6μL PCR mix (1x KAPA HiFi PCR buffer(Roche), 0.3mM dNTPs/each(Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... We then used four times fewer cycles than indicated by the qPCR to lead to logarithmic phase of amplification and prepared a PCR reaction of 50 µl PCR master mix consisting of 25µl of 2x KAPA HiFi Uracil+ hot start polymerase (Roche # KK2800) mix ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR amplification and quantification were performed on a Roche LightCycler 480 using the SYBR Green I Master reaction mix (Roche). For each experiment ...
-
bioRxiv - Neuroscience 2021Quote: ... Relative quantitative PCR assays were carried out using a LightCycler 480 and the SYBR Green I Master mix (Roche LifeScience), with Act5C as internal control for normalization of mRNA levels ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 1/10 dilution of cDNA was used for qRT-PCR analysis using the FastStart Universal SYBR Green Master Mix (Roche). Sequences of the primers used are listed in the reagents or resource table.
-
bioRxiv - Plant Biology 2021Quote: ... The abundance of specific transcript was measured by probing 1 μL cDNA by quantitative real-time PCR in a total volume of 10 µl containg 5 μL SYBR-green master mix (Roche), 0.5 μM forward and reverse primer and water ...
-
bioRxiv - Cell Biology 2020Quote: ... qRT-PCR was performed with Kapa SYBR Fast qPCR Kit Master Mix (2×) Universal (Kapa Biosystems Ltd., Wilmington, MA, USA) on a CFX connect real-time system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative RT-PCR was performed using primers described in table S2 and KAPA SYBR Fast qPCR Master Mix (KAPA Biosystems) on a LightCycler 480 Instrument II (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... the reaction was performed with 2 x Hieff qPCR SYBR Green Master Mix (Yeasen) and detected by LightCycle 480 Real-Time PCR machine (Roche). For RNA-seq ...
-
bioRxiv - Cancer Biology 2022Quote: ... The obtained cDNA was used as template in a real-time quantitative PCR reaction using the SYBR Green master mix (Roche) and a LightCycler 1.5 (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression levels were determined by qRT-PCR with KAPA SYBR FAST qPCR Master Mix Kit (Kapa Biosystems, no. KK4610). Relative expression levels were normalized to human ACTB or mouse Actb ...
-
bioRxiv - Molecular Biology 2020Quote: ... were carried out with the Applied Biosystems 7500 real-time PCR system with FastStart universal SYBR green master mix (Roche). All values were normalized to 18S RNA levels.
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative RT-PCR analysis was carried out using the ABI 7300 Real Time PCR System with Fast Start Universal SYBR Green Master Mix and ROX (Roche), and data were analyzed using the 2-ΔΔCT method ...