Labshake search
Citations for Roche :
351 - 400 of 10000+ citations for Osteopontin Human OPN ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: PCRs were carried out in 384-multiwell plates on a LightCycler 480 Instrument II (Roche) as described in Brunet et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 ng of cDNA was amplified per reaction in a 364-well plate (4729749001, Roche) with LightCycler® 480 SYBR Green I Master (4887352001 ...
-
bioRxiv - Neuroscience 2023Quote: ... Plates were run on a 45-cycle protocol using the LC 480 II system (Roche).
-
bioRxiv - Cell Biology 2023Quote: ... in a 96-well plate and qPCR was performed in a LightCycler 96 System (Roche). Data was not normalized to β-actin because only HIV relative quantity was needed ...
-
bioRxiv - Molecular Biology 2019Quote: ... and were then stained with the mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) and the FITC-tagged secondary antibody ...
-
bioRxiv - Cell Biology 2021Quote: Human stem cells and neurons lysed with RIPA lysis buffer supplemented with 5mM EDTA and protease inhibitor (Roche), for 5 minutes at room temperature and 10 minutes on ice ...
-
bioRxiv - Immunology 2021Quote: ... freshly resected human samples were cut into small fragments and digested with 0.1 mg/ml Liberase TL (Roche) and 0.1 mg/ml DNase (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: On day 0 (start of differentiation) human pluripotent stem cells were treated with 1mg/ml Collagenase B (Roche) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... human vimentin immunohistochemical staining of the paraffin sections was performed by using the Ventana Discovery XT instrument (Roche) with Ventana DAB Map detection Kit (760-124 ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized from 1 μg total RNA for each sample using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche, 05081963001), with a mixture of oligo dT and random primers ...
-
bioRxiv - Pathology 2019Quote: ... cDNA synthesis was performed with a 1 μg RNA sample using the First Strand cDNA Synthesis kit RT-PCR (Roche, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Molecular Biology 2019Quote: ... For quantitative-RT PCR analysis 1 µg of total RNA of each sample was reversed-transcribed to cDNA (Transcriptor First Strand cDNA Synthesis kit, Roche 04379012001), cDNA was diluted 1:20 and used as template for amplification reactions ...
-
bioRxiv - Biochemistry 2022Quote: ... Total RNA-seq libraries were then prepared using 1 µg of RNA from each sample and the KAPA RNA HyperPrep Kit with RiboErase (Roche KR1351) according to the manufacturer’s protocol with 10 amplification cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were prepared from 2.5 ng of each sample using either the KAPA HyperPlus Kit (replicate 1: Roche/KAPA Biosystems, KK8512) or NEBNext Ultra II DNA Library Prep Kit for Illumina (replicate 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were prepared from 2.5 ng of each sample using either the KAPA HyperPlus Kit (replicate 1: Roche/KAPA Biosystems, KK8512) or NEBNext Ultra II DNA Library Prep Kit for Illumina (replicate 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... samples were covered with the staining mixture at 37 °C for 1 h following instructions of the In Situ Cell Death Detection Kit (Roche, 11684795910). After the TUNEL reaction ...
-
bioRxiv - Bioengineering 2021Quote: ... Total RNA of 1 μg from each sample was reverse transcribed with random hexamers using Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... by the capillary method and hybridised with digoxigenin-labelled blaOXA- 58 and blaNDM-1-specific probes with an NBT/BCIP colour detection kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... The samples were boiled at 95°C for 5 minutes and diluted 1:1000 in dilution buffer provided in ATP luminescence kit HSII (Roche, Cat# 11699709001). The further assay was performed as instructed by the kit’s manual in Luminometer (Promega GloMax96 Microplate Luminometer) ...
-
bioRxiv - Plant Biology 2020Quote: ... In situ nick-end labeling of nuclear DNA fragmentation was performed for 1 h in the dark at 37°C using the In-Situ cell death detection kit (Roche Applied Science) according to the manufacturer’s manual ...
-
bioRxiv - Cell Biology 2020Quote: ... Mip1α and housekeeping gene β-actin was evaluated by quantitative RT-PCR using the LightCycler 480 SYBR Green 1 Master kit and LightCycler 480 II (Roche, Indianapolis, IN) and oligos ...
-
bioRxiv - Plant Biology 2019Quote: ... and 1 µg RNA was used for cDNA synthesis with oligo(dT)12-18 using Transcriptor first-strand synthesis kit (Roche, Basel, Switzerland). Transcript levels were measured by qRT-PCR using LightCycler 480 SYBR Green I Master (Roche ...
-
bioRxiv - Pathology 2022Quote: RNA was reverse-transcribed and amplified using the TaqMan Fast Virus 1-Step Master Mix RT-qPCR kit (LifeTechnologies, Carlsbad, CA) on the LightCycler 480 or LC96 instrument (Roche, Indianapolis, IN), and quantified by interpolation onto a standard curve made up of serial tenfold dilutions of in vitro transcribed RNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... a maximum of 1 μg of sheared DNA was used for library preparation using the KAPA HTP Prep Kit (KAPA Biosystems, KK8234) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 5 min or TRAP staining with a TRAP/ALP Stain Kit (FUJIFILM Wako Pure Chemical Corporation) for 30 min or ALP staining with NBT/BICP solution (Roche; 1:100) for 15 min followed by AR staining prepared from 1% AR Solution at pH 6.3-6.4 (MUTO PURE CHEMICALS CO. ...
-
bioRxiv - Evolutionary Biology 2024Quote: Paired-end sequencing libraries for QTL-Seq analysis were prepared using >1 μg of pooled DNA with a KAPA HyperPrep PCR-free kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Exome libraries were prepared from 1 μg of genomic DNA from each analyzed section using the Nimblegen EZ Exome kit V3 (Roche, Nutley, NJ). Paired-end 100 bp sequencing was performed on a HiSeq2500 sequencer (Illumina Inc. ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR reactions were set up using 96-well plates with FastStart Universal SYBR Green Master (Roche) and 1.5 µM primers (found in Table S2) ...
-
bioRxiv - Plant Biology 2020Quote: ... qPCR reactions were conducted on the LightCycler 480 Multiwell Plates 384-well themocycler (Roche Applied Sciences), with the following amplification program ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-PCR was performed using 96 well plates in a LightCycler® 480 Instrument by Roche. PCR reactions were performed using KAPA SYBR FAST qPCR Master Mix kit by Kapa Biosystems ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR reactions were performed in LightCycler 480 96-well plates (Roche Diagnostics, Indianapolis, IN, USA) using a 10 minute pre-incubation period at 95°C followed by 40 cycles of denaturation for 5 seconds at 95°C ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR array were performed in 384-well plates on a LightCycler 480 instrument (Roche Applied Science). The reaction mix of 102 ul of sample cDNA was prepared using 2x SA Biosciences RT2 qPCR Master Mix and 10 ul of this mixture was added into each well of the PCR array ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gene expression was analyzed by quantitative PCR (qPCR) in 384-well plates using the LightCycler480 (Roche). For each tissue ...
-
bioRxiv - Developmental Biology 2023Quote: ... Real-time quantitative PCR performed in duplicates in 384-well plates with a LightCycler 480 (Roche) using SYBR Green I Master (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR experiments were performed in a 384-well plate using LightCycler 480 SYBR Green (Roche; #4887352001) in a Roche LightCycler 480 II PCR system utilizing a Roche LightCycler 480 Software v1.5.1.62 ...
-
bioRxiv - Biochemistry 2023Quote: ... Denaturation assays were performed in a 384-well plate in a qPCR machine (Roche Lightcycler II) using a temperature range of 25-99 °C ...
-
bioRxiv - Microbiology 2024Quote: ... the master mix was added and the plate was placed in a LightCycler 480 II (Roche). The results were evaluated by Delta delta CT method considering the Cp values obtained from LightCycler 480 Software release 1.5.0 ...
-
bioRxiv - Genomics 2022Quote: ... High Sensitivity DNA Analysis Kit and KAPA SYBR FAST qPCR Kit (Roche). WGS was performed on the HiSeq X (HCS HD 3.5.0.7 ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNase free kit (Roche). RNA amount was quantified and cDNA was prepared using TaqMan Reverse Transcription Reagents (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2022Quote: A total amount of 1 μg total RNA per sample was used for sequencing libraries generation by using KAPA mRNA HyperPrep Kit (KAPA Biosystems, Roche, Basel, Switzerland) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Plant Biology 2019Quote: ... The cDNA was diluted 20-fold and used for qRT-PCR employing a LightCycler® 480 SYBR Green 1 Master PCR labelling kit (Roche Applied Sciences) and RotorGene 3000 Real time PCR machine (Corbett Research ...