Labshake search
Citations for Roche :
351 - 400 of 5231 citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 3×10−4 M MTG and 300 μg/ml human transferrin (Roche, 10652202001)) in a triple vent petri 10 cm dishes (Thermo fisher ...
-
bioRxiv - Genetics 2020Quote: ... cells were transfected with 3 μg of either wild-type (BBS2-WT-V5) or mutant BBS2 constructs (BBS2P134R-V5 and BBS2R275X-V5) using FuGENE HD (Roche, Branford, CT) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... tissue sections (n = 2-3 per tissue type) underwent deparaffinization and heat-mediated antigen retrieval on the Ventana Discovery Ultra auto-stainer platform (Roche Diagnostics, Canada), following the below instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Specific cell types within these sections were identified using a series of primary antibodies: 1:500 rabbit anti-ERG (Roche, Basel, Switzerland) for endothelial cells ...
-
bioRxiv - Bioengineering 2024Quote: The antibody concentrations in the culture supernatants were measured by ELISA using 96-well microtiter plates coated with a rat anti-rituximab antibody MB2A4 (Roche, Basel, Switzerland, cat. # MCA2260) and a Horseradish peroxidase (HRP)-conjugated detection antibody (Santa Cruz ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Cell Biology 2020Quote: Cells were pelleted and lysed with 1.5% n-dodecyl-D-maltoside (DDM) in PBS with cOmplete™ protease inhibitor (Roche) for 15 min on ice ...
-
bioRxiv - Genetics 2021Quote: ... and Tvrm323 mice (n = 4) eyes at one month of age were dissected in ice- cold PBS with proteinase inhibitor (Roche) and snap frozen in eppendorf tubes on dry ice.
-
bioRxiv - Immunology 2020Quote: ... The treated samples were purified using a C18 cartridge (Oasis HLB Plus Waters) prior to the release of N-glycans by PNGase F (recombinant from Escherichia coli, Roche) digestion ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then washed with PBS and lysed in HEPES buffer supplemented 100 μM N-ethylmaleimide and protease inhibitor cocktail (Roche). The lysates were centrifuged and incubated with 2 μg Mcl-1 antibody (S-19 ...
-
bioRxiv - Cell Biology 2024Quote: ... RPE1 cells were transfected with PB-Tet-LAP-MAP3K1 and PB-Transposase plasmid (kindly provided by N. Dimitrova) using X-tremeGENE9 reagent (Roche) and after 48 hours cells were selected with G418 ...
-
bioRxiv - Developmental Biology 2024Quote: ... were pre-washed in 0.25%BSA/DPBS and resuspended in 1ml of L3 sonication buffer (10mM TrisCl pH 8.0, 100mM NaCl, 1mM EDTA, 0.5mM EGTA, 0.1% Na-Deoxycholate, 0.5% N-Laroylsarcosine, filtered and with Roche Protease Inhibitor #04693159001) with 1% Triton ...
-
bioRxiv - Biochemistry 2023Quote: ... or HT alone and 0.001 μg/well N-terminally NL-tagged CCT5 and MAGEA3 (FL or -EE degrons) using X-tremeGene HP transfection reagent (Roche), following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... and stressed (n=4) DA neurons to prepare stranded RNAseq libraries following manufacturer’s recommendations using KAPA mRNA hyperprep (Roche Diagnostic). Each final library was quantified and qualified with 2200 Tapestation (Agilent) ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 mg of fly heads from each genotype was homogenized in 2.9 ml of lysis buffer (8 M urea, 1% SDS, 1× PBS, 50 mM N-ethylmaleimide from Sigma, and a protease inhibitor cocktail from Roche). After the centrifugation of lysates at 16,000g at 4 ºC for 5 min ...
-
bioRxiv - Bioengineering 2024Quote: ... sulfanilamide (Reagent I) and N-(1-Naphthyl)-Ethylenediamine in hydrochloric acid (Reagent II) from the “Nitrite/Nitrate Colorimetric Test” (Roche) kit (#11746081001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... All human cell lines were provided by the Roche Non-Clinical Biorepository from Roche Basel or the Roche-Innovation Center Zurich (RICZ) ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... Evaluation of the ratio Leishmania/human DNA was performed by qPCR on LightCycler480 (Roche) using SensiMix SYBR No-ROX (Bioline ...
-
bioRxiv - Genetics 2021Quote: Human BE5.1 was amplified using high fidelity PCR (Expand high fidelity system, Roche, UK) from human DNA (Cambio ...
-
bioRxiv - Genomics 2022Quote: ... fourteen non-coding regions of interest were PCR amplified from human genomic DNA (Roche) using the Phusion High-Fidelity PCR Kit (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... only donors were included that had no history of COVID-19 as well as had tested negative in three serological assays (EuroImmun-Anti-SARS-CoV-2 ELISA IgG /S1/, Siemens Healthineers SARS-CoV-2 IgG /RBD/, and Roche Elecsys Ig /Nucleocapsid Pan Ig/). PBMC were selected from heparinized full blood by a standard density gradient (Pancoll Separating Solution ...
-
bioRxiv - Developmental Biology 2021Quote: ... FISH signal was developed with tyramide reaction following O/N incubation of embryos in sheep anti-DIG antibody (Roche; Cat#11222089001) (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Molecular Biology 2023Quote: ... total RNA (50 μg) was separated on 1% agarose–formaldehyde gels and transferred to Hybond-N+ nylon membranes (Roche, Basel, Switzerland). Northern blotting was conducted with biotin-labeled DNA (bio-CTGTAGAAAGTCTGCTGATCGATACCGCGACG ...
-
bioRxiv - Microbiology 2024Quote: ... BHK cells were transfected with 3 μg of pBAC-SARS-COV-2 construct and1 μg of SARS-CoV-2 N (Delta) plasmid with the X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 ...
-
bioRxiv - Cell Biology 2023Quote: ... N-glycans were released directly using cartilage lysates following deglycosylation by overnight treatment with peptide N-glycanase F (PNGase F, 2U) (Roche, Switzerland). The supernatants containing GSLs and fOSs were dried with a centrifugal evaporator ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Tissues were homogenized in 1 ml N-PER (brain) or T-PER (other organs) + Complete Mini protease inhibitor cocktail tablet (Roche, Mannheim, Germany) in FastPrep Lysing Matrix D tubes on a FastPrep homogenizer ...
-
bioRxiv - Molecular Biology 2021Quote: ... were transiently transfected for 24 h with 9,36 μg of hNAA40-flag expression vectors and using 35 μl Fugene HD (Roche, cat. n°04709705001) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: We then targeted the N-(nucleoprotein) gene of SARS-CoV-2 virus with Roche Lightcycler 480 RNA Master Hydrolysis Probes (Roche Basel, Switzerland) with primers developed in house ...
-
bioRxiv - Cell Biology 2021Quote: Total protein from cells or mouse tissues (n=3 per genotype) were extracted using the M-PER protein lysis buffer (ThermoScientific, Beverly, MA) containing protease inhibitors (Roche, Indianapolis, IN). Approximately 25 μg of total protein was electrophoresed on 4-12% SDS-PAGE gels and transferred to PVDF membranes ...
-
bioRxiv - Immunology 2022Quote: Anti-SARS-CoV-2 (N protein) IgM/IgG levels in the serum were measured using an Elecsys Anti-SARS-CoV-2 with cobas8000 (Roche Diagnostics KK) at the Department of Clinical Laboratory ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from the mPFC tissues of CamK2A-Cre;Gpr158fl/fl mice and the controls (n = 4) at the age of 8 weeks with Tripure Isolation Reagent (Roche, Mannheim, Germany). RNA-sequencing (RNA-seq ...
-
bioRxiv - Genomics 2024Quote: ... 0.5% N-Lauroylsarcosine) and resuspended in 100 μl of complete LB3 (LB3 containing 1 × Roche cOmplete Mini Protease Inhibitor Cocktail (Roche, Cat.N: 04693159001)) ...
-
bioRxiv - Neuroscience 2020Quote: ... The RNA probes complementary to human METTL7B cDNA (NM_152637.2) were labeled with digoxigenin-UTP (Roche). After acetylation ...
-
bioRxiv - Genetics 2022Quote: ... Probes were then mixed with 20μg of COT Human DNA (Roche, 11 581 074 001) and 79μg of Salmon sperm DNA (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 ml of additional human dynein lysis buffer supplemented with cOmplete protease inhibitor cocktail (Roche) was added to the frozen cell pellet ...
-
bioRxiv - Microbiology 2020Quote: ... according to the manufacturer’s instructions and ethanol precipitated with human Cot-1 DNA (Roche, Germany) and herring sperm DNA (Sigma Aldrich) ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Cancer Biology 2023Quote: ... and retrotranscribed cDNA quantified using the Universal Human Probe Roche library (Roche-Diagnostics, Barcelona, Spain). Assays were made in triplicate and normalized to TBP expression (ΔΔCT method) ...
-
bioRxiv - Neuroscience 2023Quote: Recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche, Welwyn Garden City, UK) or placebo (PL ...
-
bioRxiv - Cell Biology 2024Quote: Human islets (20-30K IEQ) were dissociated the day after isolation with collagenase P (Roche) digestion for 15 minutes at 37 ℃ ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies to the spike protein receptor binding domain and nucleocapsid were measured by the Roche Elecsys Anti-SARS-CoV-2 S and Anti-N assay (Roche Diagnostics, Indianapolis, IN), per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50 ng of labeled probe was mixed with 10 μg of human Cot-1 DNA (Roche) and 10 μg each of salmon sperm DNA and E ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal Probe Library (UPL) Probefinder software for human (Roche, version 2.53) or using previously published sequences and adjusted to be intron-spanning ...
-
bioRxiv - Cancer Biology 2024Quote: ... were transfected into the human 293FT cell line using X-tremeGENE 9 DNA transfection reagent (Roche). After 48 hours ...
-
bioRxiv - Immunology 2023Quote: ... the medium was supplemented with 30 IU/mL recombinant human interleukin 2 (IL-2) (Proleukin, Roche). Electroporated T cells were kept in culture ON and then used directly or frozen.
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies used for the immunostaining include human ERα rabbit monoclonal antibody (Roche Diagnostics, 790-4325), human PR rabbit monoclonal antibody (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regions to sequence were selected with the SeqCap EZ Human Exome Library v3.0 (Roche Applied Science) according to the manufacturer’s instructions and underwent 2 × 151 base-pair sequencing on Hiseq 4000 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... human skin was cut into thin pieces and incubated overnight at 4°C with dispase (Roche) at 2.4 U/ml ...
-
bioRxiv - Physiology 2024Quote: Blood samples from adult mice were collected from male and female animals (n=7 for each gender) by decapitation into tubes containing protease inhibitors (Roche Life Sciences, Basel, Switzerland) and 0.5% EDTA (v/v).