Labshake search
Citations for Roche :
351 - 400 of 1145 citations for Dengue Virus Serotype 3 Envelope Protein HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were then prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Physiology 2023Quote: ... 3 µL of Light Cycler 480 SYBR® Green I Master mix (Roche Diagnostics, Switzerland), 0.24 µL of each primer (10X ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.17 mg/mL 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; Roche, Basel, Switzerland) at room temperature for 1 h (Brn3acKOAP/cKOAP mice ...
-
bioRxiv - Genomics 2023Quote: ... For 3-color detection the following antibody dilutions were made: anti-digoxigenin (Roche, cat. 11333089001) 1:10 ...
-
bioRxiv - Developmental Biology 2024Quote: ... NBT/BCIP (4-nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolylphosphate, Roche, 11681451001) was added after thoroughly washing samples ...
-
bioRxiv - Biochemistry 2024Quote: ... A ∼3:1 ratio of X-tremeGENE™ 9 DNA Transfection Reagent (Roche, XTG9-RO) was added to the mixture prior to incubation and application on HEK293T cells using standard methods 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Whole brain lysate was precleared with Protein G agarose (Roche, 11243233001) and the supernatant was immunoprecipitated with CB1R antibody overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... The lysate was pre-cleared with protein G-agarose beads (Roche) and incubated with anti-FLAG M2 agarose beads (Sigma #A2220) ...
-
bioRxiv - Molecular Biology 2020Quote: ... HA-tagged proteins were detected with mouse (Covance) or rat (Roche) monoclonal anti-V5 antibodies at 1 μg/ml or 12.5 ng/ml respectively ...
-
bioRxiv - Molecular Biology 2020Quote: ... The supernatants were incubated and rotated with Protein A beads (Roche) with an anti-Mcm2 antibody (Bethyl ...
-
bioRxiv - Plant Biology 2020Quote: ... protein blotting was performed using antibodies against GFP (Roche, Basel, Switzerland) and HA (Roche).
-
bioRxiv - Plant Biology 2021Quote: ... HA-tagged proteins were detected with Anti-HA-Peroxidase (Roche #12013819001) at a dilution of 1:5,000 ...
-
bioRxiv - Microbiology 2021Quote: ... and pre-cleared with 80 μL of Protein-A agarose (Roche) and 100 μg BSA ...
-
bioRxiv - Microbiology 2019Quote: ... The lysates were pre-cleared with protein A-agarose beads (Roche) for 3 h and then incubated with anti-β1-integrin antibodies (MAB2000 from Millipore ...
-
bioRxiv - Microbiology 2022Quote: ... To prevent protein degradation a protease inhibitor was added (Complete, Roche). Afterwards ...
-
bioRxiv - Immunology 2020Quote: ... urinary protein level using a P800 biochemical analyzer (Roche, Mannheim, Germany), and urinary RBC and white blood cell (WBC ...
-
bioRxiv - Genetics 2019Quote: ... The GFP-tagged proteins were probed with anti-GFP antibody (Roche) (1:1,000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protease inhibitor cocktail and protein phosphatase inhibitor cocktail were from Roche. MS023 (SML1555) ...
-
bioRxiv - Immunology 2022Quote: ... containing phosphoSTOP and protein inhibitors cocktail (100 mg/ml, Roche 11836153001) was added to the tube at the ratio of 1 ml buffer per 100 mg tissue ...
-
bioRxiv - Plant Biology 2023Quote: ... A volume containing 50 ul of Protein A - agarose beads (Roche) was then added to the extract before overnight incubation ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein visualization was performed by chemiluminescence using LumiLight western blotting (Roche) and ImageQuant 800 (GE Healthcare).
-
bioRxiv - Molecular Biology 2022Quote: ... protein was extracted with EB2 supplemented with PhosStop (Roche, Indianapolis, IN) and were subjected to IP with 15 μl of settled a-FLAG beads (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... followed by incubation with 20 μl of protein G-beads (Roche) for 1 h on a rotator at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... The target protein was purified using His-Tag Purification Resin (Roche) according to the manufacturer instructions.
-
bioRxiv - Developmental Biology 2023Quote: ... Antibody-chromatin complexes were recovered using protein G-agarose beads (Roche). After washing ...
-
bioRxiv - Biochemistry 2023Quote: ... FLAG-tagged proteins were detected with a mouse anti-FLAG (Roche) antibody diluted 1:1000 ...
-
bioRxiv - Pathology 2023Quote: ... The expressed proteins were detected by using anti-HA-HRP (Roche) at a dilution of 1:5,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were visualized using Lumi-Light Western Blotting Substrate (Roche, Switzerland). The signal was detected using the ChemiDOC MP Imaging System (Bio-rad ...
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal mouse antibodies were used to detect GFP-tagged proteins (Roche) (dilution 1:2000 ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Neuroscience 2019Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics). Color development was allowed to proceed overnight or was stopped after 2-3 hours (for quantification of npba expression in Vs/Vp ...
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... This was followed by a 1.5-2 hour incubation in Collagenase-P (3 mg/mL, Roche) diluted in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...