Labshake search
Citations for Roche :
351 - 400 of 8569 citations for Cow WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: PCR amplification of RNA editing containing sequence were performed by using cDNA and gDNA as templates with KAPA HiFi HotStart ReadyMix PCR kit (Roche, Germany) and the following program ...
-
bioRxiv - Genetics 2019Quote: ... Real-time PCR was performed in a final volume of 20 µl containing 20 ng of cDNA using SYBR Fast Universal qPCR Kit (Kapa Biosystems) and analyzed using the Quant Studio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: Full-length HIV clones were quantified by reverse transcriptase (RT) enzyme-linked immunosorbent assay (ELISA) (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Creatinine levels were measured with the COBAS INTEGRA Creatinine Jaffé Gen.2 Kit (Roche Diagnostics, Indianapolis, IN). To assess severity of proteinuria ...
-
bioRxiv - Microbiology 2022Quote: ... amplified using primers LN112 and LN113 (Table 2) and the PCR DIG Synthesis Kit (Roche, Basel, Switzerland) as a probe ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 1x Protease Inhibitor Cocktail (Roche). Lysates were sonicated with Sonorex Digitec (Bandelin ...
-
bioRxiv - Microbiology 2019Quote: ... containing Protease inhibitors cocktail (Complete, Roche). Resuspended A549 cells were incubated in ice for 1 h and kept in suspension by frequently vortexing ...
-
bioRxiv - Neuroscience 2022Quote: ... containing collagenase A (Roche, 1.5mg/ml) and DNAse 1 (Roche ...
-
bioRxiv - Immunology 2022Quote: ... containing protease/phosphatase inhibitor cocktail (Roche). Protein concentration was measured using a BCA assay (Pierce) ...
-
bioRxiv - Cell Biology 2019Quote: ... containing a protease inhibitor cocktail (Roche) and sodium orthovanadate (2 mM) ...
-
bioRxiv - Microbiology 2019Quote: ... containing protease inhibitors (Roche Applied Science). Tissue lysates were normalized for protein content with Pierce 660nm Protein Assay (Thermo Scientific) ...
-
bioRxiv - Immunology 2019Quote: ... containing 40 mg/L Liberase (Roche) at a rate of 5 mL/min ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing freshly added phosphatase (phosSTOP, Roche) and protease inhibitors (cOmplete EDTA-free ...
-
bioRxiv - Neuroscience 2020Quote: ... containing protease inhibitors (Complete Mini; Roche). Lysates were centrifuged (10.000g for 10 min at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... containing protease inhibitors (Complete Mini; Roche)) ...
-
bioRxiv - Cell Biology 2020Quote: ... containing protease inhibitor cocktail (Roche #11873580001). The lysates were boiled for 10 min at 95°C and clarified by centrifugation at 12 ...
-
bioRxiv - Microbiology 2020Quote: ... containing protease inhibitors (Roche, MA, USA). SARS-CoV-2 S-Ectodomain expressing Tni cell media were treated with different concentrations of bromelain (5 ...
-
bioRxiv - Neuroscience 2020Quote: ... containing a protease inhibitor cocktail (Roche) and phosphatase inhibitors (AG Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... containing an antiprotease cocktail (Roche Diagnostic). Cells were incubated for 20 minutes on a rotating wheel ...
-
bioRxiv - Neuroscience 2022Quote: ... containing protease and phosphatase inhibitors (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... D6750)] containing protease inhibitor cocktail (Roche, 04693159001) and phosphatase inhibitor cocktail (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... containing proteinase and phosphatase inhibitors (Roche), centrifuged for 10 min at 8,000 × g at 4°C and supernatant extracted and stored at −80°C ...
-
bioRxiv - Neuroscience 2021Quote: ... containing protease inhibitor cocktail (Roche #4693159001) and PhosSTOP (Roche #4906837001 ...
-
bioRxiv - Neuroscience 2020Quote: ... containing collagenase P (Roche, Penzberg, DE) (0.2 U/mL ...
-
bioRxiv - Microbiology 2021Quote: ... containing protease inhibitors (Roche Applied Science). Cell lysates were normalized for protein content with Pierce 660nm Protein Assay (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... containing 2x protease inhibitor cocktail (Roche); centrifuged at 12,000 rpm for 10 min at 4 °C to get rid of cell debris ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing protease inhibitor cocktail (Roche, 4693159001). Lysates were placed on ice for 30 minutes followed by sonication for 2 minutes with 10 seconds on/off cycle and centrifugation for 10 minutes at 10000g at 4°C in a microcentrifuge ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing protease inhibitor (Roche, Basel, Switzerland) and phosphatase inhibitor (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2019Quote: ... containing 1% RNAse inhibitor (Roche, #03335399001) and 1% DNAse I (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... containing DIG DNA-labelling mix (Roche) and primers DENV-1 3’UTR FW (AGTCAGGCCAGATTAAGCCATAGTACGG ...
-
bioRxiv - Pathology 2021Quote: ... containing complete mini protease inhibitors (Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Cell Biology 2019Quote: ... containing protease inhibitors (cOmplete tablets; Roche) and phosphatase inhibitors (PhosSTOP ...
-
bioRxiv - Biochemistry 2020Quote: ... containing 2x protease inhibitor cocktail (Roche); protein concentrations were determined by BCA assay ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 0.8U/ml Liberase TM (Roche) and 1mg/ml DNAse (Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing a protease inhibitor cocktail (Roche). Equal amounts of proteins were resolved using sodium dodecyl sulfate-polyacrylamide gel electrophoresis ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 7.4) containing protease inhibitors (Roche) and phosphatase inhibitors (5mM sodium fluoride ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing protease inhibitor (Roche, Basel, Switzerland). The resultant lysates were centrifuged at 6000 rpm for 10 mins ...
-
bioRxiv - Systems Biology 2021Quote: ... pH 8.0) containing protease inhibitor (Roche) for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... containing protease inhibitor cocktail (Roche 11697498001), then incubated on ice for 45 minutes with occasional gentle agitation ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing Protease inhibitors (Roche, cat# 04693159001) and Phosphatase inhibitors (Thermo Fisher Scientific ...
-
CREB5 reprograms nuclear interactions to promote resistance to androgen receptor targeting therapiesbioRxiv - Cancer Biology 2021Quote: ... containing protease inhibitor cocktail (Roche, 11836145001). Cells were then sonicated with a Covaris sonicator to yield DNA fragments averaging around 3000 nucleotides ...
-
bioRxiv - Cell Biology 2021Quote: ... containing cOmplete protease inhibitor cocktail (Roche) and phosphatase inhibitor cocktail (Nacalai ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing cOmplete protease inhibitor cocktail (Roche) and PMSF (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2022Quote: ... containing 1x protease inhibitor (5892970001, Roche), 1x phosphatase inhibitor (4906837001 ...
-
bioRxiv - Molecular Biology 2022Quote: ... containing complete protease inhibitor cocktail (Roche). Lysed cell suspensions were rotated in 4°C for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... containing cOmplete Protease Inhibitor Cocktail (Roche), PhosSTOP phosphatase inhibitors (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... containing 10 μM oseltamivir carboxylate (Roche) and 10 μM zanamivir (GSK ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... containing “Complete” protease inhibitor cocktail (Roche) for 15 min on ice with occasional mixing ...
-
bioRxiv - Microbiology 2022Quote: ... containing 10 μM oseltamivir carboxylate (Roche) and 10 μM zanamivir (GSK ...
-
bioRxiv - Immunology 2022Quote: ... containing protease inhibitor cocktail (Roche, 589297001) and phosphatase inhibitors (Roche ...