Labshake search
Citations for Roche :
351 - 400 of 4802 citations for Cow Hepatoma Derived Growth Factor HDGF ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... the KAPA HyperPrep kit (Roche Cat. No 07962363001) was used with New England Biolabs NEBNext Multiplex Oligos for Illumina (NEB #E7335) ...
-
bioRxiv - Genomics 2020Quote: ... NimbleGen SeqCap EZ Accessory Kit v2 (Roche: 07145594001), and previously published custom biotinylated DNA oligonucleotides (R1 and HS-38 viewpoints (26) ...
-
bioRxiv - Immunology 2021Quote: ... The depleted RNA was fragmented prior to cDNA synthesis followed by Illumina adaptor ligation using KAPA RNA HyperPrep kit (Roche). The library was analyzed using High Sensitivity DNA ScreenTape 1000 (Agilent ...
-
bioRxiv - Immunology 2020Quote: ... quantified using the KAPA Library Quantification Kit (Roche), and then sequenced on an Illumina MiSeq with 1×125 bp single end reads using a primer that anneals to the 5’ adaptor sequence just prior to the oligo sequence (GCTCGGGGATCCGAATTCTACGCTGAGT).
-
bioRxiv - Cancer Biology 2021Quote: ... with the LightCycler 480 Probes Master Kit (Roche) and Taqman probes (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... were pre-processed with KAPA HyperPlus Kit (Roche) followed by exons enrichment with KAPA HyperCapture Kit (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... Smart SYBR Green fast Master kit (Roche Diagnostics) and specific primers (Supplemental Table 3) ...
-
bioRxiv - Plant Biology 2019Quote: ... Using RTS 100 Wheat Germ CECF Kit (Roche), GUN1 protein was expressed in RTS ProteoMaster (Roche) ...
-
bioRxiv - Genomics 2019Quote: ... Library preparation using KAPA mRNA HyperPrep Kit (Roche) was automated using the Hamilton robot ...
-
bioRxiv - Cell Biology 2019Quote: ... using the KAPA SYBR FAST qPCR Kit (Roche) and gene-specific oligonucleotide primers obtained from the Harvard Primer Bank database (Spandidos et al. ...
-
bioRxiv - Genetics 2019Quote: ... using a DIG RNA labeling kit (Roche, 11175025910). Probes for wtGH1 and Ghrhr mRNAs were manually hybridized at 0.5 ng/ml ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the KAPA Library Quantification kit (KAPA BIOSYSTEMS). Libraries then were sequenced by Illumina Hiseq 2500 in rapid mode.
-
bioRxiv - Developmental Biology 2021Quote: ... with RiboMap fixation and BlueMap detection kits (Roche) for in situ hybridization ...
-
bioRxiv - Plant Biology 2020Quote: ... The Transcriptor First Strand cDNA Synthesis Kit (Roche) was used to reverse transcribe 0.5 μg of extracted RNA into 20 μL of cDNA ...
-
bioRxiv - Microbiology 2019Quote: ... and Lumi-Light Western Blotting Substrate Kit (Roche). FLAG-tagged FLAG-FimV Protein (Rossmann et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... using the PCR DIG Probe Synthesis kit (Roche). The probe sequences are available in Supplementary Table 2.
-
bioRxiv - Cancer Biology 2019Quote: ... and ChromoMap DAB Kit (760-159, Roche/Ventana) were applied for detection of UBR5 IHC ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the KAPA Low Throughput Library Preparation kit (Roche) was used to construct Illumina sequencing libraries according to the manufacturer’s instructions with two exceptions ...
-
Heatrich-BS enables efficient CpG enrichment and highly scalable cell-free DNA methylation profilingbioRxiv - Genomics 2021Quote: ... quantified using Kapa Library quantification kits (Kapa Biosystems) and sequenced using MiSeq v3 150 cycle kit (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... the Roche High Pure PCR template kit (Roche Molecular Systems ...
-
bioRxiv - Genetics 2020Quote: ... or KAPA LTP library preparation kit (Kapa Biosystems). Libraries were multiplexed and sequenced on HiSeq 2500 or NextSeq 500 (Illumina).
-
bioRxiv - Evolutionary Biology 2021Quote: ... and SeqCap EZ Pure Capture Bead Kit (Roche) following the manufacturer’s instructions for SeqCap EZ Library SR (Roche) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The Kapa Library Quantification Kit (KAPA Biosystems: KK4824) was used for precise quantification of the library pool ...
-
bioRxiv - Immunology 2020Quote: ... and a KAPA library quantification kit (Roche #7960140001). Samples were sequenced on a HiSeq 2500 (Illumina ...
-
bioRxiv - Biochemistry 2021Quote: ... and ATP Bioluminescence assay Kit CLS II (Roche) were used to detect relative levels of NAD ...
-
bioRxiv - Cancer Biology 2020Quote: ... the In Situ Cell Death Detection Kit (Roche) was used per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... libraries were prepared using KAPA HyperPlus Kits (Roche). 25 ng DNA was used to prepare the libraries ...
-
bioRxiv - Cell Biology 2021Quote: ... The In Situ Cell Death Detection Kit (Roche Diagnostics Corporation 12156792910 ...
-
bioRxiv - Immunology 2021Quote: ... Kappa SybrFast qPCR kit (Kapa Biosystems, Wilmington, MA) and thermal cycler (CFX96 Real-Time System ...
-
bioRxiv - Neuroscience 2020Quote: ... using the KAPA HiFi PCR kit (Roche Sequencing). IntN and IntC were amplified from the Npu DnaE inteins with site directed mutagenesis according to Lockless and Muir (2009) ...
-
bioRxiv - Cancer Biology 2021Quote: We used SeqCap EZ Custom Enrichment Kit (Roche, Basel ...
-
bioRxiv - Developmental Biology 2022Quote: ... After qPCR quantification (KAPA library quantification Kit, Roche), sequencing were performed on the Illumina NovaSeq 6000 using 2 x 150 cycles to get ∼40 M paired-end reads per sample.
-
bioRxiv - Developmental Biology 2022Quote: ... KAPA Illumina library quantification kit (KAPA Biosystems, MA) was utilized to quantify RNA-seq libraries ...
-
bioRxiv - Cell Biology 2022Quote: ... or the fluorescein labeling kit for FISH (Roche). Probe for cmyb and WISH protocols have been previously described84–86.
-
bioRxiv - Genomics 2022Quote: ... using KAPA SYBR Fast qPCR Kit (KAPA Biosystems) and the primers shown in Table S1 Absolute quantification of the copy number was performed using a known amount of plasmid containing the primer region ...
-
bioRxiv - Developmental Biology 2022Quote: ... DIG-RNA labelling kit (Sp6/T7) (Roche Diagnostics) was used for DIG or Fluorescein RNA labelling following instructions ...
-
bioRxiv - Immunology 2022Quote: The High Pure RNA Isolation Kit from Roche Molecular Systems ...
-
bioRxiv - Genetics 2022Quote: ... KAPA Stranded mRNA-Seq kit (KAPA Biosystems, MA) was used to generate indexed Illumina platform sequencing libraries ...
-
bioRxiv - Immunology 2022Quote: ... Using KAPA SYBR Fast qPCR Kit (Kapa Biosystems), we amplified cDNA fragments and proceeded with qPCR reactions on CFX96 Thermal Cycler Real Time System (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... After qPCR quantification (KAPA library quantification Kit, Roche), sequencing were performed on the Illumina NovaSeq 6000 using 2 x 150 cycles to get ∼40 M paired-end reads per sample.
-
bioRxiv - Genomics 2022Quote: ... using SeqCapEpi Developer Medium Enrichment kit (NimbleGen, Roche), following User’s Guide and manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: Using the KAPA HiFi HotStart PCR kit (Roche), double-stranded DNA was generated from JVOpool-001 ...
-
bioRxiv - Immunology 2022Quote: ... KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems) and the manufacturer’s suggested cycling protocol were used to complete the PCR reaction with the following primers ...
-
bioRxiv - Genomics 2022Quote: ... After quantification with KAPA Library Quantification kit (Roche), libraries were sequenced on a Novaseq 6000 Sequencer (Illumina).
-
bioRxiv - Microbiology 2022Quote: For KAPA HiFi HotStart ReadyMix kit (Kapa Biosystems), the first round of PCR was prepared as follows ...
-
bioRxiv - Molecular Biology 2022Quote: ... NimbleGen SeqCap EZ Accessory Kit v2 (Roche: 07145594001), and previously published custom biotinylated DNA oligonucleotides (R1 and HS-38 viewpoints12 ...
-
NSC-derived exosomes enhance therapeutic effects of NSC transplantation on cerebral ischemia in micebioRxiv - Neuroscience 2022Quote: ... in situ cell death detection kit (Roche, Germany) was used to detect the cell apoptosis according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Transcriptor First-Strand cDNA Synthesis Kit (Roche, USA) was used for synthesis of cDNA using random hexamer primers ...
-
bioRxiv - Genomics 2022Quote: ... After quantification with KAPA Library Quantification kit (Roche), libraries were sequenced on a Novaseq 6000 Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: Cell Proliferation Kit I (MTT) (Roche, Cat#11465007001) was used to assess cell viability 48 hrs post initiation of MTX challenge ...