Labshake search
Citations for Roche :
351 - 400 of 2437 citations for Contactin Associated Protein Like 3 CNTNAP3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... after which DIG antibody (Roche) was added to the blocking buffer at a ratio of 1:10,000 and incubated for an additional 1/2 min at room temperature ...
-
bioRxiv - Developmental Biology 2019Quote: ... antibodies and NBT/BCIP (Roche) or INT/BCIP (Roche ...
-
bioRxiv - Developmental Biology 2020Quote: ... Anti-HA antibody (11867423001, Roche) was used according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... mouse anti-GFP antibody (Roche) and the HRP conjugated goat anti-mouse secondary antibody (Bangalore Genei) ...
-
bioRxiv - Cell Biology 2021Quote: ... Commercial primary antibodies: EGFP (Roche), Myc (9E10 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse anti-GFP antibodies (Roche) were used at a dilution of 1:1,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP antibody (Cat#11814460001 Roche), IKKε Rabbit Ab (#2905S ...
-
bioRxiv - Cell Biology 2022Quote: ... DIG-AP-antibody (11093274910 Roche) incubation was then performed overnight at 4 °C (1:2000 in blocking solution) ...
-
bioRxiv - Neuroscience 2021Quote: ... GFP mouse antibody (Roche #11814460001), KIF13A rabbit antibody (Thermo Fisher Scientific PA5-30874) ...
-
bioRxiv - Cell Biology 2021Quote: ... monoclonal anti-GFP antibody (Roche) and polyclonal antibody raised against Erg6 (kind gift from G ...
-
bioRxiv - Biochemistry 2020Quote: Anti-HA (12CA5) antibody (Roche) was immobilized on Protein A (PA-W ...
-
bioRxiv - Developmental Biology 2019Quote: ... anti-HA antibody (3F10, Roche), anti-Smad2 antibody (#5339 ...
-
bioRxiv - Genetics 2020Quote: ... Anti-digoxigenin-AP antibody (Roche) at 1:5000 dilution was used to detect probe hybridisation ...
-
bioRxiv - Biochemistry 2022Quote: ... antibodies against DIG (Roche 11333089001) or tubulin (TU-20 ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies (α-HA3F10 Roche were incubated overnight at 4°C in PBS containing 1% BSA and 0.02% sodium azide ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-DIG antibody (Roche, #11093274910) was added in a dilution of 1:2.000 and embryos incubated overnight at 4°C on a nutator ...
-
bioRxiv - Cell Biology 2023Quote: ... Polyclonal anti-GFP antibody (Roche) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... Fab fragments antibody (Roche, 11426339810) was added (1:2000 dilution in PBT + 2 mg/ml BSA + 2% sheep serum ...
-
bioRxiv - Cell Biology 2023Quote: ... Antibodies against Myc (9E10; Roche), 14-3-3 (H-8 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-DIG-POD antibody (Roche) was diluted 1:500 in TNB buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... and anti-GFP antibody (Roche).
-
bioRxiv - Neuroscience 2024Quote: ... alkaline phosphatase-conjugated antibody (Roche). The sections were subsequently rinsed and incubated in the dark with a NBT/BCIP solution (Nitroblue tetrazolium chloride/ 5-bromo-4chloro-3-indyl-phosphate ...
-
bioRxiv - Cell Biology 2024Quote: ... or α-HA antibodies (Roche).
-
bioRxiv - Cell Biology 2024Quote: ... or α-HA antibodies (Roche).
-
bioRxiv - Neuroscience 2019Quote: ... Supernatants were incubated with 30 µl Protein G-Agarose (Roche) per ml lysate for 1 hour at 4 °C and washed three times with lysis buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by incubation with Protein G Agarose beads (Roche, 1124323301) (15μl ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 μl bed volume of Protein A Agarose (Roche 11134515001) was added the following day to each sample ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunoprecipitations were performed using Protein G Agarose beads (Roche, 1124323301) or anti-FLAG (M2 ...
-
bioRxiv - Genetics 2022Quote: ... 40 μl of protein G agarose beads suspension (Roche 11243233001) (settled beads volume 20 μl ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were visualized by Lumi-Light Plus detection reagent (Roche).
-
bioRxiv - Microbiology 2021Quote: ... 100 µl of protein G-coupled agarose bead resin (Roche) were washed (2 × CL buffer 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... proteins were digested with 200 ng trypsin (Roche, Basel, Switzerland) shaking at 600 rpm at 37°C for 17 hours ...
-
bioRxiv - Cancer Biology 2023Quote: Proteins were extracted using RIPA buffer (Thermo) and proteinase (Roche) plus phosphatase (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... Resuspended protein samples were digested with endoproteinases Lys-C (Roche) and trypsin (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proteins were digested by adding trypsin (proteomics grade, Roche) at a 1/50 enzyme/protein ratio (w/w ...
-
bioRxiv - Molecular Biology 2024Quote: ... The proteins were digested by adding trypsin (proteomics grade, Roche) at a 1/50 enzyme/protein ratio (w/w ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pre-cleared with protein A-agarose beads (Roche, Germany). Primary antibody incubations were carried out for 2 hours at 4°C ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1-3 ng of ChIP DNA with KAPA Library Preparation Kit (KAPA Biosystems) and NimbleGen SeqCap Adaptor Kit A or B (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...