Labshake search
Citations for Roche :
351 - 400 of 2089 citations for Adenovirus Type 5 Particles CMV GFP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... for each sample 350µl of type 1 rat-tail collagen (Roche) dissolved in acetic acid 0.2%v /v was supplemented with 15µl of sterile dd H2O ...
-
β-catenin signaling via astrocyte-encoded TCF7L2 regulates neuronal excitability and social behaviorbioRxiv - Neuroscience 2020Quote: ... The numbers of DNA-containing viral particles was measured using the SYBR Green I Master Kit (Roche) and a LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral particles were quantified by real-time PCR Q-PCR using LightCycler480 SYBR Green I Master (Roche) and primers targeting the flanking sequence of ITR2 (GTAGATAAGTAGCATGGC and CTCCATCACTAGGGGTTCCTTG ...
-
bioRxiv - Zoology 2023Quote: Automated nucleic acid extraction from samples was performed using Magnetic Particle Processors (MagMax, KingFisher, Roche and others) and appropriate kits ...
-
bioRxiv - Cell Biology 2021Quote: The plasmids FUG-T2A-GFP-Cre and control GFP were purchased from Addgene #66691 and lentiviral particles were produced in HEK-293T cells using X-tremeGene 9 DNA Transfection Reagent (Roche). Upon ultracentrifugation concentrated virus particles were stored at −80°C and used to infect pancreatic ductal organoid cultures as previously described (Huch et al. ...
-
bioRxiv - Synthetic Biology 2023Quote: ... We incubated 5μl of clarified crude lysates containing rAAV particles with 50 units (U) of DNAse I (Roche) for 15hr at 37°C ...
-
bioRxiv - Microbiology 2020Quote: α-GDV1-GFP-DD and α-Pfs16 IFAs were performed with methanol-fixed cells using mouse mAbs α-GFP (1:200) (Roche, #11814460001) and α-Pfs16 (1:500 ...
-
bioRxiv - Biophysics 2021Quote: ... The oocytes were digested with type I collagenase (1.5 mg/mL, Roche) in OR-2 ...
-
bioRxiv - Genomics 2020Quote: ... 400 ng/ml DNase I Type IV (Roche PVT GmbH Waiblingen, Germany) in L15 medium (Gibco)] and carefully cut into small pieces ...
-
bioRxiv - Genomics 2020Quote: ... 40 μg/ml DNase I Type IV (Roche PVT GmbH Waiblingen, Germany)) samples were incubated for 15-20 min at 37°C ...
-
bioRxiv - Systems Biology 2022Quote: ... Both types of lysis buffer were supplemented with phosSTOP (Roche, catalog # 4906837001) and cOmplete (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: The experiments in all cell types were performed with Fugene HD (Roche) transfection reagent ...
-
bioRxiv - Plant Biology 2020Quote: ... A monoclonal anti-GFP antibody (Roche, cat. no. 11814460001) was used at 1:3000 dilution and combined with a 1:20000 rabbit anti-mouse secondary antibody (Agrisera ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-GFP (Roche, 11814460 001, 1:2000), monoclonal mouse anti V5 (Invitrogen R960-25 ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-GFP antibody 13.1 + 7.1 (Roche, Merck, Darmstadt, Germany) or anti-CSP repeat antibody – mAB 3D11 (Yoshida et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-GFP (1:1000, 0.4 µg/ml; Roche).
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-GFP antibody (1:500, Roche, RRID:AB_390913) diluted in TNB was added to each slide under a bridged coverslip and incubated at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... then blotted with mouse anti-GFP antibody (Roche 11814460001) and anti-mouse-HRP secondary (Cell Signaling 7076) ...
-
bioRxiv - Neuroscience 2021Quote: ... a concentration of 1:500 anti-GFP (Roche 11814460001) and 1:5000 anti-mouse HRP (Millipore AP308P ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1 uL of anti-GFP antibody (Roche 11814460001) were used to pull down DMA-1::GFP and KPC-1::GFP overnight at 4C ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-GFP (7.1+13.1, Roche, 11814460001; 1:1000), rabbit anti-Caveolin (BD Biosciences 610059 ...
-
bioRxiv - Molecular Biology 2020Quote: ... A monoclonal mouse anti-GFP antibody (Roche, Nr. 11814460001) was used to detect ENDU-2::EGFP in the gonad.
-
Proteasome granular localization is regulated through mitochondrial respiration and kinase signalingbioRxiv - Cell Biology 2022Quote: ... Antibodies used were anti-GFP (1:500; Roche, #11814460001), and anti-Pgk1 (1:10,000 ...
-
bioRxiv - Plant Biology 2019Quote: ... and immunoblot analysis was performed using anti-GFP (Roche), anti-ubiquitin ...
-
bioRxiv - Biochemistry 2019Quote: ... mouse-anti-GFP (1:1000) (Roche Cat# 11814460001, RRID:AB_390913), and rabbit-anti-Hxk1 (1:3000 ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were probed with α-Gfp (Roche, Freiburg, Germany) and α-actin (MP Biomedicals ...
-
bioRxiv - Plant Biology 2020Quote: ... and incubated with primary α-GFP (monoclonal, #11814460001, Roche) or α-HA (H9658 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Sigma-Aldrich #11814460001-Roche; 1:5000), rabbit anti-GGA1 (Bethyl Laboratories #A305-368A ...
-
bioRxiv - Neuroscience 2021Quote: ... and anti-GFP (mouse polyclonal, Roche, 11867423001, 1:5000). After washing three times with TBST buffer ...
-
bioRxiv - Immunology 2021Quote: ... mouse α-GFP (clones 7.1 and 13.1, Roche, Switzerland) and rabbit α□HA (polyclonal ...
-
bioRxiv - Cell Biology 2021Quote: ... monoclonal anti-GFP mouse IgG (Roche, 11814460001, 1:5000), polyclonal anti-Hexokinase 1 rabbit IgG (United States Biological ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and mouse anti-GFP (clones 7.1 and 13.1, Roche) at a dilution of 1:3000 for blots exposed to film ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-GFP (mouse monoclonal, Clone 7.1, 11814460001, ROCHE, Sigma); anti-RFP (rat monoclonal ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were probed with mouse anti-GFP (Roche, 11814460001), rabbit anti-Cdc2 (CDK1 ...
-
Kinetochore- and chromosome-driven transition of microtubules into bundles promotes spindle assemblybioRxiv - Cell Biology 2022Quote: ... mouse IgG monoclonal anti-GFP (Ref 11814460001, LOT42903200, Roche), diluted 1:100 ...
-
bioRxiv - Cell Biology 2022Quote: ... or anti-GFP at a 1:5,000 dilution (Roche) using a previously described procedure 62 ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... and GFP- tagged pCREB3L3 using X-tremeGENE 9 (Roche). Cells were grown on coverslips ...
-
bioRxiv - Biochemistry 2019Quote: ... mouse monoclonal anti GFP IgG (catalog number 11814460001; Roche), rabbit polyclonal anti tubulin IgG (catalog number SC-9104 ...
-
bioRxiv - Cell Biology 2019Quote: ... incubated with 1:400 mouse anti-GFP IgG (Roche) for 1 hr at RT ...
-
bioRxiv - Molecular Biology 2019Quote: ... Blots were developed with GFP mouse antibody from Roche Applied Science (Indianapolis ...
-
bioRxiv - Pathology 2019Quote: ... Proteins were detected using polyclonal antibodies against GFP (Roche), Histone H3 (GeneTex ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP (Roche, 11814460001, 1/10.000 for WB), goat anti-CTSB (R&D Systems ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal anti-GFP was from Roche (Indianapolis, IN). All secondary antibodies used for immunoblotting were Near-InfraRed fluorescent conjugates (Jackson Immunoresearch ...
-
bioRxiv - Cell Biology 2019Quote: ... primary antibodies mouse anti-GFP (Roche 11814460001, 1:500) and rabbit anti-BiP MRA-1246 (BEI resources (1:100 ...
-
bioRxiv - Cell Biology 2021Quote: ... The primary antibodies used are the anti-GFP (Roche), the anti-CCR5 2D7 mAb (BD-Biosciences) ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-GFP antibody was from Roche (clones 7.1-13.1). Anti-human GAPDH (sc-47724 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-GFP (Roche Diagnostics Cat. No. 11814460001), Donkey anti-Rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP clones 7.1 and13.1 (Sigma Roche: 118144600010), 1:1000 ...
-
SLC15A4 favors inflammasome function via mTORC1 signaling and autophagy restraint in dendritic cellsbioRxiv - Immunology 2022Quote: ... mouse monoclonal anti-GFP was from Roche (Indianapolis, IN); rabbit anti-mTOR (7C10) ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-GFP (Roche, 11814460001; 1:10,000 for WB), mouse anti-α-tubulin (Cell Signaling Technology ...