Labshake search
Citations for Roche :
351 - 400 of 8668 citations for 4 4 Fluoro 2 hydroxyphenyl methyl 2 6 bis 1 methylethyl 5 propyl 3 pyridinemethanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Cobas TaqMan RealTime HIV-1 (version 1 or 2; Hoffmann-La Roche, Basel, Switzerland) or the Abbott RealTime HIV-1 assay (Abbot Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... in a 2:1:1 ratio using X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Supernatants from each buffer were dialyzed in 25 mM Tris-HCl and 5 mM EDTA pH 8.0 overnight at 4°C and subsequently digested with 200 mg/ml pronase (Roche). Peptides were precipitated with 5% trichloroacetic acid (TCA ...
-
bioRxiv - Neuroscience 2020Quote: ... lysates were incubated at 4 °C overnight with rabbit anti-GFP (1:1000, Roche) and pull down was performed with magnetic proteinA beads (Millipore ...
-
bioRxiv - Genomics 2024Quote: ... and incubated overnight at 4°C with Anti-Dig-AP antibody (Roche, 1:5000) in 1% lamb serum ...
-
bioRxiv - Biochemistry 2024Quote: ... tissues were lysed in RIPA buffer (ratio 1:4) supplemented with protease inhibitors (Roche) and protein was quantified by BCA Protein Assay Kit assay.
-
bioRxiv - Developmental Biology 2024Quote: ... 4 h in 1:1500 solution of anti-digoxigenin antibody (Roche, cat no. 11333089001):blocking solution ...
-
bioRxiv - Immunology 2024Quote: ... beads and lysis buffer (20 mM Tris pH 7.4, 120 mM NaCl, 1 mM EDTA, 1% Triton-X-100, 0.5% sodium deoxycholate, 1× protease inhibitor cocktail [Roche])) ...
-
bioRxiv - Biochemistry 2020Quote: For Figures 2 and 6: Cells or embryos were lysed in RIPA buffer supplemented with a cocktail of protease inhibitor (Roche). Total protein was resolved on SDS polyacrylamide gels (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... Glucose content was then measured by spectrophotometry after a 2 enzymes reaction with hexokinase and glucose-6-phosphate dehydrogenase (Roche).
-
bioRxiv - Plant Biology 2021Quote: ... 4 μl of PCR-grade water (Roche), 1 μl of the corresponding primer pair (10 μM each ...
-
bioRxiv - Neuroscience 2021Quote: ... 4°C) supplemented with protease (Roche, #11697498001) and phosphatase inhibitors (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 μg/ml Laminin (Roche Basel, Switzerland), and 2 μg/ml Fibronectin (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was tested by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Roche, Mannheim, Germany), according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay (11465007001, Roche Diagnostics, Mannheim, Germany) was performed according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: The cytotoxicity assays were performed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Roche, ref:11465007001) protocols according to the previous study [47] with few modifications ...
-
bioRxiv - Biochemistry 2024Quote: Cell metabolic viability was measured by the colorimetric MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Roche). After treatments ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 30 mM mgCl2 x 6 H2O and 5 mg/mL glucose-6-phosphate dehydrogenase (Roche Diagnostics) in 0.1 M potassium phosphate buffer pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... and recombinant mouse interleukin-2 (mIL-2, 100 U/ml; Roche, Basel, Switzerland), and subjected to flow cytometry as described elsewhere ...
-
bioRxiv - Neuroscience 2023Quote: ... 150 μL of RIPA double-detergent buffer (2% deoxycholate, 2% NP-40, 2% Triton X-100 in RIPA homogenizing buffer) supplemented with protease inhibitor cocktail (Roche, cat# A32953) was added to the tissue homogenate followed by incubation on a shaker for 1 h at 4ºC ...
-
bioRxiv - Cell Biology 2024Quote: ... just after the resection the tissue was dissociated into small pieces (∼2 mm × 2 mm × 2 mm) and then digested for 30 minutes at 37°C with Collagenase (2 mg/mL, Roche, Basel, Switzerland) and DNase I (400 U/mL ...
-
bioRxiv - Biochemistry 2021Quote: Cardiac myofibrils were prepared from left ventricular trabecular strips pre-stretched overnight to a sarcomere length of about 2 µm in rigor buffer (20 mM HEPES pH 7, 140 mM KCl, 2 mM MgCl2, 2 mM EGTA, 1 mM DTT, Roche complete protease inhibitor) at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Microbiology 2021Quote: ... Epidermal and dermal sheets were prepared after incubation overnight at 4°C with 4 U/ml dispase II (Roche) in PBS by gently separating dermis and epidermis each as intact sheets (Rahn et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... pellets were resuspended in lysis buffer (50 mM HEPES pH 8, 400 mM NaCl, 75 mM Imidazole pH 8, 5% v/v glycerol, 5 mM 2-Mercaptoethanol, supplemented with Roche Protease Inhibitor Tablets) and lysed using an Emulsiflex-05 homogenizer ...
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM β-mercaptoethanol) with 2 mM phenylmethylsulfonylfluorid (PMSF) or EDTA-free protease inhibitor cocktail tablet (Roche), 20 mg lysozyme (Sigma ...
-
bioRxiv - Plant Biology 2023Quote: ... 80 mM KCl, 0.2 mM spermine, 5 mM 2-ME, 0.5 mM spermidine, 0.2% IGEPAL CA-630, Roche mini EDTA-free Protease Inhibitor Cocktail ...
-
bioRxiv - Cell Biology 2022Quote: ... Supernatants were diluted 1:4 with ice-cold dilution buffer (1× phos-stop [Roche], 0.5% NP-40, 1 mM DTT) and centrifuged again at 15,000 rpm for 15 minutes at 4°C to precipitate actomyosin components ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... pH 7.5) with the addition of 2 mg·ml-1 collagenase (Roche, Indianapolis). Defolliculated oocytes were injected with ENaC cRNAs into the cytosol (25 ng per oocyte in 50 nl of RNase-free water ...
-
bioRxiv - Neuroscience 2020Quote: ... nuclei were stained with 4,6 diamine-2-phenylindole (1:25000, DAPI, Roche) in PBS 1X for 1 minute ...
-
bioRxiv - Microbiology 2024Quote: ... 2) step - 1:0.85 using Kapa HyperPure Beads (Roche, cat. no. 07983298001). Sequencing was performed using Pair-end 2×100 cycle mode on the Illumina NovaSeq 6000 system (NovaSeq 6000 S1 Reagent Kit v1.5 200 cycles Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 or 2 mL of the cOmplete His-Tag purification resin (Roche) equilibrated with the solubilization buffer 2 was added ...
-
bioRxiv - Biophysics 2023Quote: ... and protease inhibitor tablets (1 per 2 L culture, Roche, Basel, Switzerland) and lysed via sonication ...
-
bioRxiv - Microbiology 2024Quote: ... and protease inhibitor tablets (1 per 2 L culture, Roche, Basel, Switzerland) and lysed via sonication ...
-
bioRxiv - Genomics 2024Quote: ... 1 mM Tris(2-carboxyethyl)phosphine (TCEP) and complete protease inhibitor (Roche)) and added to the oligo-bound magnetic beads for 2 hours at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... then washed twice with Buffer 2 (0.05% w/v Saponin, 1× Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... This was spun down (5 minutes at 1800 RMP, 4°C) and the pellet then digested in 10ml collagenase/dispase (1mg/ml; Roche) and DNase I type IV (40µg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... Incubation of primary antibodies was performed overnight at 4 °C in 5% non-fat dry milk or 3.5% BSA (Roche, 10735086001). After three washes in PBS-T ...
-
bioRxiv - Cell Biology 2021Quote: ... and phosphatase inhibitors (2 mM activated Na3VO4, 2 mM NaF and 1x PhosSTOP (Roche)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... plates were fixed with 2% paraformaldehyde/ 2% sucrose and stained with DAPI (#10236276001, Roche). Plates were photographed with the IN Cell Analyzer 2200 high content analyzer (GE Healthcare) ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% Tween-20] and maintained for 2 hours in 2% blocking reagent (11096176001, Roche) in TNT ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were incubated overnight at 4 °C with rat anti-HA antibody (1:500 - Roche) and then with secondary goat anti-rat IgG antibody coupled to Alexa 568 (Invitrogen/Life Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated with anti-DIG-POD antibody (Roche; 1:1000 in TNB; 12 hr, 4 °C), and washed in TNT (3 × 20 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Sections were incubated overnight at 4°C with Anti-Digoxigenin-AP antibody (1:2000, Roche) in blocking solution ...