Labshake search
Citations for Roche :
351 - 400 of 3400 citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: Fibroblast proliferation was assessed using a 5-bromo-2’-deoxyuridine (BrdU) incorporation assay (colorimetric) from Roche (Indianapolis, IN, USA) for 48 h following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2020Quote: ... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 100 mL of cold lysis buffer (50 mM HEPES pH 8, 175 mM NaCl, 5 % glycerol, 1 mM EDTA and 2 tablets of protease inhibitors by Roche). The bacterial solution was then incubated at room temperature (RT ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5 mM tris(2-carboxyethyl)phosphine (TCEP) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) and EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation and the proteins in the supernatant were purified by gravity Ni-nitrilotriacetic acid (Ni-NTA ...
-
bioRxiv - Bioengineering 2021Quote: ... S-phase Synchronous HeLa S3 cells were washed with ice-cold 1× PBS and lysed in a swelling buffer (20 mM HEPES, pH 7.5, 2 mM MgCl2, 5 mM KCl, 1 mM Dithiothreitol [DTT], and protease inhibitor cocktail [Roche; #11836170001]) supplemented with energy-regenerating mixture ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were lysed using 2-5 times the volume of RIPA lysis buffer supplemented with 1x protease inhibitor cocktail (Roche), PMSF (1 mM ...
-
bioRxiv - Microbiology 2021Quote: ... the remaining dermis was washed in Ca2+ and Mg2+ free PBS 5 times and incubated in a digestion buffer containing 2 mg/ml collagenase A (Roche), 100 µg/ml of DNase I (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from 58 macro-dissected regions of slides G1-5 in samples UH1-UH16 and 30 regions of slides F1-5 in samples UH17-UH23 and UH25-UH27 (Supplementary Table 2) using the High Pure FFPE RNA isolation kit (Roche). For UH4 ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured for 24 hours in the presence of SARS-CoV-2 specific MPs [1 μg/mL] or 5 μg/mL phytohemagglutinin (PHA, Roche) in 96-wells U-bottom plates at 1×106 PBMCs per well ...
-
bioRxiv - Genomics 2020Quote: ... was synthesised commercially and then labelled with digoxigenin-11-2’-deoxyuridine-5’-triphosphate (DIG-11-dUTP) using terminal transferase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... water was exchanged for 100 µL water with 5 µM L-012 (WAKO chemicals) and 2 µg/mL horseradish peroxidase (Type II, Roche). After the leaf discs were treated with 1 µM 3-OH-C10:0 (stock in MeOH ...
-
bioRxiv - Molecular Biology 2022Quote: ... The loci of interest were first amplified with 15 cycles of PCR from 2 μL (∼100 ng) of genomic DNA eluate using a 5 μL Kapa HiFi HotStart polymerase reaction (Roche). The first PCR was then diluted with 25 μL of DNAse-free water ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2-10 5 micron sections were extracted using the High Pure FFPE RNA Isolation kit (Roche Life Sciences, Penzberg, Germany) under RNase free conditions following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... with probe prepared by nick translation of a double-stranded PCR product bearing the bcd ORF using alkali-stable digoxigenin-11-2’-deoxyuridine-5’-triphosphate (Roche), visualizing with alkaline-phosphate coupled sheep anti-digoxigenin Fab fragments (Roche ...
-
bioRxiv - Immunology 2023Quote: ... tumor tissue was dissected into approximately 1– 5 mm3 fragments and digested with collagenase Type D (2 mg/ml; Roche) and DNase I (1 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 5 mM EGTA, 1 mM DTT, 2 mM MgCl, and one EDTA-free protease inhibitor cocktail tablet; Roche) and sonicated in an ice bath for 6 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... glands were minced into paste and incubated in 5 mL DME/F-12 medium (HyClone, #SH30023.1) with 2 mg/mL collagenase A (Roche #10103578001), 100 units/mL hyaluronidase (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... cell pellets were resuspended in HR buffer (50 mM Tris-HCl, 5 mM MgCl2, 250 mM sucrose, 2 mM TCEP and protease inhibitor t (Roche), pH 7.4) ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked in 5% low-fat milk in TBS-T for 2 hours and probed with 1:5000-diluted mouse anti-GFP (Roche) or rabbit anti-ATG8 (Agrisera ...
-
bioRxiv - Cell Biology 2024Quote: ... then with 1 ml of Western blot buffer (2% SDS, 5% Glycerol, 50 mM Tris-HCl, 0.2 M EDTA + cOmplete protease inhibitor cocktail tablet (Roche, 11697498001) + PhosSTOP (Roche ...
-
bioRxiv - Immunology 2023Quote: ... 3 mM ATP (Roche), 25 μg/ml MSU (InvivoGen) ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... The cross-linking reaction was quenched by incubating the cells with 0.125 M glycine for 5 min with mild agitation at room temperature followed by centrifugation at 3,000 rpm for 5 min at 4°C with a subsequent PBS wash (containing 0.01X protease inhibitor cocktail or PIC; #11836170001, Roche Applied Science, Indianapolis, USA). Following the complete removal of PBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... sections were blocked with 10% HI-serum for 2 h and incubated overnight at 4°C with alkaline phosphatase-labeled sheep anti-dig antibody (11093274910, Roche; 1:2500). After washing ...
-
bioRxiv - Physiology 2021Quote: ... 1:500 goat anti-rabbit (AlexaFlour 488; A-11008) and 1:1000 4′,6-diamidino-2-phenylindole (DAPI; Roche 10236276001; Basel, Switzerland). After secondary incubations ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissue was transferred to a 50 mL conical tube and resuspended in DPBS/BSA containing collagenase B (2-4 mg/mL) (Roche, Mannheim, Germany) and DNase I (2,000 U/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... cover slips were washed with PBS and incubated for 10 min at room temperature with 1 g/mL 4’,6 diamidino-2-phenylindole (DAPI, Sigma Aldrich, Roche, #10236276001) in PBS ...
-
bioRxiv - Immunology 2020Quote: ... The proliferation rate of lymphocytes was measured using 5-Bromo-2-deoxyuridine (BrDU) assay as per the manufacturer instructions (Cell Proliferation ELISA BrDU, Roche, USA).
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480; Roche Diagnostics, Mannheim, Germany) with SYBR Green I dye and gene-specific primers (Supplemental Table S8) ...
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Cell Biology 2022Quote: ... of siCon or siRictor NIH3T3 cells co-expressing Flag-NDRG1 WT were homogenized in 2% SDS + 5 mM DTT to retrieve proteins in solution supplemented with complete EDTA-free protease inhibitor (Roche, 11873580001) and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... 300 mM NaCl and 2 mM β -mercaptoethanol) per 5 × 108 cells in the presence of EDTA-free anti-protease cocktail (complete from Roche). Lysis was performed with two cycles of freezing (− 180 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... All the signals were visualized by adding 3-3′-Diaaminobenzidinetetrahydrochloride (DAB substrate) solution (Roche) to the slides and counterstained with haematoxylin ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were washed and the secondary antibodies applied (dilutions listed below) with 4′-6-diamidino-2-phenylindole (DAPI: Cat # 10-236-276-001, Roche Diagnostics, Indianapolis, IN) at 1:1,000 for 1 hour ...
-
bioRxiv - Cell Biology 2020Quote: ... resuspended in SDS-PAGE loading buffer (50 mM TrisC1 pH 6.8, 2% SDS, 0.1% bromophenol blue, 10% glycerol, 4% β-mercaptoethanol, 1 mM PMSF, 1x Roche cOmplete protease inhibitor cocktail) and boiled for 10 min ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% TritonX-100, 0.5% Na-DOC, 1 mM EDTA, 2 mM PMSF and 1x Roche protease inhibitor cocktail). After sonification for 5 min and clarification with centrifuge at 16,000 g at 4 °C ...