Labshake search
Citations for Roche :
351 - 400 of 1939 citations for 3 2 Methoxy phenoxymethyl piperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Neuroprotective Effects of VEGF-B in a Murine Model of Aggressive Neuronal Loss With Childhood OnsetbioRxiv - Neuroscience 2023Quote: ... Terminal transferase (2 µl/ml; Roche, Basel, Switzerland) and biotinylated dUTP (1 µl/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μl of micrococcal nuclease (Nuclease S7, Roche) was added and the lysates were incubated at 25 °C for 18 min using a thermal cycler (Techne-Prime ...
-
Identification of plants functional counterparts of the metazoan Mediator of DNA Damage Checkpoint 1bioRxiv - Cell Biology 2023Quote: ... 2 µl/ml Benzonase) containing protease inhibitors (Roche) and sonicated for 2 min (5’’on/5’’off ...
-
bioRxiv - Immunology 2022Quote: ... and IL-2 (50/250 IU/ml) (Roche). The glucose medium consisted of glucose-free RPMI 1640 (Gibco ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 μl alkaline phosphatase (Roche Basel, Switzerland) were added and incubated overnight in the dark at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... and 10 U mL−1 IL-2 (Roche) for 48 h at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mg/ml Lysozyme and protease inhibitors (Roche) per 1 L of pelleted culture ...
-
Phosphorylation of the Smooth Muscle Master Splicing Regulator RBPMS Regulates its Splicing ActivitybioRxiv - Molecular Biology 2022Quote: ... and 2 cOmpleteTM mini protease inhibitor cocktail (Roche) tablets were added to the cell suspension followed by cell lysis using a French Press (Stansted) ...
-
bioRxiv - Neuroscience 2022Quote: ... 2% SDS and a cocktail protease inhibitor (Roche)] ...
-
bioRxiv - Cell Biology 2023Quote: ... 5mM EDTA and 2% Protease inhibitor (Roche, Complete) boiled for 10 min at 70°C in SDS loading buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.01% digitonin + 2 U/mL RNase inhibitor (Roche). Epicardial preparations (2 biological replicates at 10PWC ...
-
bioRxiv - Microbiology 2023Quote: ... and 2) a KAPA HiFi PCR kit (Roche) was used to perform the amplification in place of the reagents included in the Nextera XT kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 tablets complete EDTA-free protease inhibitor (Roche)) followed by 5 min incubation at 4°C ...
-
bioRxiv - Physiology 2024Quote: ... with 2 mg/ml collagenase P (Roche, #11213873001) in the tube rotating at 40 rpm for 35 minutes at room temperature and washed two times in HBSS with 1% BSA ...
-
bioRxiv - Immunology 2024Quote: ... 500uL of Ni+2-NTA beads (Roche, #5893682001) were packed onto a 12mL column and equilibrated into six packed bead volumes of equilibration buffer (50mM Tris ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μL 20 mg/mL Glycogen (Roche, 10901393001)) at 37°C for 2 hr and subsequently subjected to Proteinase K (15 μL 10% SDS ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 mM PMSF and 1 % protease inhibitor (Roche). The samples were then lysed by sonication and centrifuged to collect the supernatant for the following protein purification ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 EDTA-free protease inhibitor tablets (Roche). The cell suspension was stirred for 1 hour and then sonicated for 50 seconds in 5-second pulses with 25-second waiting time at 70% amplitude using a 130 W microtip sonicator (Vibra Cell) ...
-
bioRxiv - Microbiology 2024Quote: ... pH 7.5) supplemented with 2× protease inhibitor (Roche). The cells were sedimented and resuspended in 0.2 mL 0.1 M ammonium bicarbonate containing 2% (w/vol ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 eComplete Protease Inhibitor Cocktail tablets (Roche). Cells were lysed by sonication (1 s on/3 s off ...
-
bioRxiv - Neuroscience 2024Quote: 5’-bromo-2’-deoxyuridine (BrdU) (Roche, Indianapolis, IN) was dissolved in 0.9% NaCl and injected intraperitoneally (i.p. ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 EDTA-free protease inhibitor tablets (Roche). The cell suspension was stirred for 1 hour and then sonicated for 50 seconds in 5-second pulses with 25-second waiting time at 70% amplitude using a 130 W microtip sonicator (Vibra Cell) ...
-
bioRxiv - Immunology 2021Quote: ... which were subsequently incubated with digestion buffer (IMDM supplemented with 2% FBS, 1 mg/mL Collagenase D [Roche], 2 U/mL DNase I [Life Technologies] and Dispase II [Roche]). The digested brain parenchyma ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mM MgCl2; 2 mM EGTA pH 8.0; 0.1% Triton X-100; 0.1 mM PMSF; 1x Roche Complete protease inhibitors cocktail) supplemented with increasing NaCl concentrations (80-600 mM ...
-
bioRxiv - Cancer Biology 2022Quote: NGS libraries were prepared from extracted gDNAs following a 2-step PCR protocol with 2 x KAPA Mastermix (KK2612, KAPA Biosystems). For spleen Tregs and CD4s ...
-
bioRxiv - Cancer Biology 2024Quote: ... The aqueous phase from each MaXtract tube (∼400 µl) was then transferred to 1.5 ml tubes containing 2 µl of 2 µg/µl glycogen (Roche, Cat# 10901393001), 1 ml ethanol was added ...
-
bioRxiv - Immunology 2024Quote: ... we quantified phosphorylated STAT5 (pSTAT5) levels following stimulation with recombinant human IL-2 (rhIL-2; Roche, Basel, CH-BS, Switzerland; [28]). Single-cell suspensions of splenocytes were obtained from 12-week-old NOD mice five weeks after in vivo treatment with IgG2a isotype control or anti-CD226 mAb ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...